We narrowed to 12 results for: gnal
-
TypeGuide...antibody and conjugate chosen. Signal Amplification The amount of signal needed from a specific antibody...abundant target, it obscures fainter signals. Fluorophores can emit signals that overlap with each other. Choose... Other Affinity Reagents Handling Visualization Signal Amplification Application Overview Quantification...Fc region. This allows for the amplification of signals by having multiple secondary antibodies binding...sdAbs is usually achieved by conjugation of a signaling molecule directly to the sdAb, or by using a secondary... incorporated in the sdAb. sdAbs can have weak signals due to their monovalent nature. Darpins - Darpins...single arm of the Y). They can be conjugated to signaling molecules and are often used in clinical applications...
-
Chemogenetics Guide
TypeGuide...classified by the signaling protein that the receptors couple to: Gq-DREADDs Gq-DREADDs signal through the ...Gi-DREADDs Gi-DREADDs signal through the Gαi/o G-protein and inhibit neuronal signaling by inhibiting adenylate...Gs-DREADDs Gs-DREADDs signal through the Gαs G-protein and activate neuronal signaling by increasing intracellular...small molecules that do not affect endogenous signaling, therefore allowing precise control over the cell...then activates G-proteins to modulate downstream signaling. GPCRs have been shown to be involved in a wide...of biological processes, including initiating signaling pathways in inflammation and neurotransmission...couples to β-arrestin to activate noncanonical GPCR signaling independent of G proteins. This DREADD, termed... -
Optogenetics Guide
TypeGuide...NpHR with addition of trafficking signal from Kir2.1 and ER export signal provide improved membrane targeting...light to detect, measure, and control molecular signals and cells in order to understand their functions...are genetically-encoded reporters of molecular signals; e.g., calcium indicators In this overview, we ... the absorption spectrum or adding trafficking signals to localize opsins to the cell membrane. Microbial...566 eArch 3.0 Arch with addition of trafficking signal from Kir2.1 566 ArchT Light-activated outward proton...566 eArchT 3.0 ArchT with addition of trafficking signal from Kir2.1 566 Leptosphaeria rhodopsins Mac Light-activated...maculans 540 eMac 3.0 Mac with addition of trafficking signal from Kir2.1 540 Plan Your Optogenetics Experiment... -
Adenovirus Guide
TypeGuide... deleted, except for the ITRs and the packaging signal, which is located adjacent to the left ITR, resulting...Flp-FRT recombination systems to excise the packaging signal from the HV genome or using other plasmids instead...vector platforms within the gene therapy landscape . Signal Transduction and Targeted Therapy, 6 (1), 53. https...recombination. Psi (Ψ) in cis Packaging or encapsidation signal located at the left arm of the genome adjacent ...viral genome packaging. In helper viruses, this signal is flanked by loxP sites so they can be excised...Non-specific immune response that responds to general signals of infection or damage. Insertional mutagenesis... -
Sequencing Primers
TypeGuide...Reverse pBABE 5' CTTTATCCAGCCCTCAC Psi packaging signal, 5' of MCS in pBABE vectors Forward pBAD Forward...Alpha-factor TACTATTGCCAGCATTGCTGC Alpha factor signal sequence Forward Amp-R ATAATACCGCGCCACATAGC 5' ...GCGTGAATGTAAGCGTGAC CYC1 transcriptioin termination signal/td> Reverse DsRed1-C AGCTGGACATCACCTCCCACAACG 3... -
CRISPR Guide
TypeGuide...PAM) The PAM sequence (NGG) serves as a binding signal for Cas9, but the exact sequence depends on which...the aptamer improves stability and amplifies the signal for better imaging of genomic loci, as in the CRISPR-Sirius...degraded by Cas12a, it will release a quantifiable signal that indicates the presence of your target DNA ...cleaves the reporter as well, and a quantifiable signal is produced, indicating the presence of that specific...Pederson, T. (2018). CRISPR-Sirius: RNA scaffolds for signal amplification in genome imaging. Nature Methodss...Vale, R. D. (2014). A Protein-Tagging system for signal amplification in gene expression and fluorescence... -
Adeno-associated virus (AAV) Guide
TypeGuide... nuclear export. Poly(A) signal in cis The polyadenylation or poly(A) signal aids in the nuclear export...serve as origins of replication and also act as signals for packaging. Figure 1: Wild-type AAV genome. ...used to detect, measure, and control molecular signals of cells (commonly neurons) in response to light... -
Science Guides
TypeGuide...applications, which often use antibodies conjugated to a signaling molecule, can be used to capture, quantify, and...receptors to selectively control and investigate cell signaling pathways. Receptors are remotely controlled via...light to detect, measure, and control molecular signals and cells in order to understand their functions... -
Modular Cloning Guide
TypeGuide...transcriptional unit (for example, a promoter, a 5' UTR, a signal peptide, a protein-coding gene, and a terminator...backbones, fluorescent proteins, protein tags, and signal peptides, for use in a range of organisms including... -
Promoters
TypeGuide... Promoters Plasmids 101: Terminators and PolyA signals More Plasmids 101 topics Content last reviewed:... -
Gamma-Retroviral Vector Guide
TypeGuide...increased nuclear export. Psi (Ѱ) in cis RNA packaging signal; recognized by nucleocapsid proteins and essential... -
Lentiviral Vector Guide
TypeGuide...Rev protein binds. Psi (Ѱ) in cis RNA packaging signal; recognized by nucleocapsid proteins and essential...