We narrowed to 301 results for: rigi

...Originally published Jan 27, 2015 and last updated Dec 17, 2020. This post was contributed by Jordan ...

... red genes from a plasmid with a heat sensitive origin of replication.  Once the recombineering system...

...use, including all information provided in the original reference library, as well as GC%, reverse compliment...

...especially immune cells and cells of epithelial origin. Suppressing function, creating tolerance, and ...

...nanoparticles, maintaining intensity at ~85% of its original value after 60 minutes of illumination, highlighting...

...Gautier et al., 2008). Although based on the same original enzyme, SNAP-tag and CLIP-tag show good specificity...

...specific to the lineage of the target cell in the original somatic cells [41]. The in vivo and in vitro methods...

...Originally published Jan 28, 2016 and last updated Sep 10, 2020 by Jennifer Tsang. CRISPR makes it easy...

...EBNA1) based episomes: These plasmids carry the origin of replication (oriP) element and the cis-acting...

...This blog post was originally written by Caroline LaManna, published Mar 8, 2016. The updated and expanded...

...adenine base editing (TadCABE) This post was originally written by Mary Gearing in August 2016 and was...

...methods such as electrophysiological recordings. The origins of these methods are naturally occurring viruses...

...validation data, or follow the references to find the original publication and ensure that it includes validation...

...GTGGACTCTTGTTCCAAACTGG F1 origin Forward F1ori-R AGGGAAGAAAGCGAAAGGAG F1 origin Reverse GAL1 AATATACCTCTATACTTTAACGTC...promoter Forward pACYC-F TGAAGTCAGCCCCATACGAT p15A origin Forward pAd-CMV GCTAGAGATCTGGTACCGTC For cloning...Forward pBR322ori-F GGGAAACGCCTGGTATCTTT pBRS322 origin Forward pBRforBam CTTGGAGCCACTATCGAC In pBR322 ...Forward pGP704-R AACAAGCCAGGGATGTAACG R6K gamma origin, 3' of MCS in pGP704 vector Reverse pHybLex Reverse...Reverse SV40pro-F TATTTATGCAGAGGCCGAGG SV40 promoter/origin Forward SV40-spliceR CACAAAGATCCGGACCAAAG SV40 ...

...Reference Molecular Biology Reference Jump To: Origins of Molecular Genetics The Genetic Code Recombinant...Cloning Techniques Promoters Sequencing Primers Origins of Molecular Genetics The concept of genes as carriers...diverse applications — Although plasmids were originally used to understand protein coding gene function...their simplest form, plasmids require a bacterial origin of replication ( ori ), an antibiotic resistance...structure of a plasmid. Plasmid Element Description Origin of Replication ( ori ) DNA sequence which directs...often containing only a bacterial resistance gene, origin of replication, and an MCS. They are small and ...

... K. phaffii ). GoldenPiCS Kit Yeast Expression Brigitte Gasser , Diethard Mattanovich , and Michael Sauer... and Cultivarium Tools 189 plasmids, including origins of replication and selection markers for a variety...Kit Genome Engineering, CRISPR, Yeast Expression Brigitte Gasser Plasmids to perform CRISPR/Cas9 mediated...

...Overview of the basic CRISPR mechanism. CRISPR was originally employed to knock out target genes in various..., be sure to check the library information and original publication to see if a library is suitable for... of your amplified library matches that of the original library. Next, you’ll need to generate lentivirus...

... and can either be used while suspended in the original media or isolated and placed in a buffer. Antibody...antibodies can distinguish between different species of origin, isotypes, and isotype subclasses of a primary ...

...Braun, S. E. (2021). HIV-based lentiviral vectors: Origin and sequence differences. Molecular Therapy — Methods...

...Before starting, check the Methods section of the original report or recent publications using your chosen...