Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 303 results for: rigi

Showing: 281 - 300 of 303 results

  14. Technical Design of a Western Blot

    Type
    Blog Post
    ...validation data, or follow the references to find the original publication and ensure that it includes validation...

  15. Using AAV for Neuronal Tracing

    Type
    Blog Post
    ...methods such as electrophysiological recordings. The origins of these methods are naturally occurring viruses...

  16. Molecular Biology Reference

    Type
    Guide
    ...Biology Reference Jump To: Molecular Biology Basics Origins of Molecular Genetics Plasmid Elements Working ...Genetic Code Webpage and Blog References Protocols Origins of Molecular Genetics The concept of genes as carriers... this purpose, which includes a DNA replication origin, an antibiotic-resistance gene, and a region in...parental cell, and are thus termed clones of the original cell. The plasmid DNA is similarly referred to...their simplest form, plasmids require a bacterial origin of replication ( ori ), an antibiotic-resistance...common plasmid elements: Plasmid Element Description Origin of Replication ( ori ) DNA sequence which directs... cultured human cells. Although plasmids were originally used to understand protein coding gene function...

  17. Sequencing Primers

    Type
    Guide
    ...reverse primer F1ori-F GTGGACTCTTGTTCCAAACTGG F1 origin, forward primer GAL1 AATATACCTCTATACTTTAACGTC (...forward primer pACYC-F TGAAGTCAGCCCCATACGAT p15A origin, forward primer pAd-CMV GCTAGAGATCTGGTACCGTC For...vector pBR322ori-F GGGAAACGCCTGGTATCTTT pBRS322 origin, forward primer pBRforBam CTTGGAGCCACTATCGAC In... primer pGP704-R AACAAGCCAGGGATGTAACG R6K gamma origin, 3' of MCS in pGP704 vector, reverse primer pHybLex...primer SV40pro-F TATTTATGCAGAGGCCGAGG SV40 promoter/origin, forward primer SV40-spliceR CACAAAGATCCGGACCAAAG...

  18. Modular Cloning Guide

    Type
    Guide
    ... K. phaffii ). GoldenPiCS Kit Yeast Expression Brigitte Gasser , Diethard Mattanovich , and Michael Sauer... and Cultivarium Tools 189 plasmids, including origins of replication and selection markers for a variety...Kit Genome Engineering, CRISPR, Yeast Expression Brigitte Gasser Plasmids to perform CRISPR/Cas9 mediated...

  19. CRISPR Guide

    Type
    Guide
    ...target sequence present in the gRNA. CRISPR was originally employed to knock out target genes in various..., be sure to check the library information and original publication to see if a library is suitable for... of your amplified library matches that of the original library. Next, you’ll need to generate lentivirus...

  20. Antibody Guide

    Type
    Guide
    ... and can either be used while suspended in the original media or isolated and placed in a buffer. Antibody...antibodies can distinguish between different species of origin, isotypes, and isotype subclasses of a primary ...
Showing: 281 - 300 of 303 results