Skip to main content

We narrowed to 813 results for: cell

Showing: 751 - 800 of 813 results
  1. Science Guides

    Type
    Guide
    ...receptors to selectively control and investigate cell signaling pathways. Receptors are remotely controlled...and genetic engineering to measure and manipulate cells (frequently neurons) and their governing biomolecular...detect, measure, and control molecular signals and cells in order to understand their functions. Read More...
  2. Sequencing Primers

    Type
    Guide
    ...CCCTTGAACCTCCTCGTTCGACC Murine stem cell virus Forward MSCV Reverse CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus Reverse ...CCCTTGAACCTCCTCGTTCGACC Murine stem cell virus Forward MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus Reverse MT1...pLXSN 5' (MSCV) CCCTTGAACCTCCTCGTTCGACC Murine stem cell virus, same as MSCV Forward pMRB101-F AAGATGCAGGCAGCTGAGTT...
  3. Promoters

    Type
    Guide
    ...element controls the rate of transcription. Bacterial cells contain sigma factors that assist the RNA polymerase...other promoters can drive expression in specific cells or under different conditions. Promoter Expression...ribosomal RNA (rRNA), which is a main component of a cell’s ribosome structure. Ribosomes are the site of protein...
  4. Modular Cloning Guide

    Type
    Guide
    ...assembly of cellular circuits using Golden Gate-based cloning methods for use in mammalian cells. These can...MoClo Yeast Toolkit (YTK) to optimize secretion and cell surface display of proteins of interest. Yeast Secrete... create multigene constructs expressed in the cellulose-producing Komagataeibacter species. Ralstonia-...
  5. Molecular Cloning Techniques

    Type
    Guide
    ...homology. While this approach doesn't work in other cell types, it can be a major time- and cost-saver for...
  6. MAPK Plasmids

    Type
    Collection
    ...Mitogen-activated protein kinases (MAPKs), also known as extracellular signal-regulated kinases (ERKs), are serine/...threonine-specific protein kinases. They regulate diverse cellular programs by acting as an integration point for...
  7. Tags and Other Markers

    Type
    Collection
    ...catalog that target epitope tags and other common cellular proteins. These ready-to-use recombinant monoclonal...
  8. Synthetic Biology - Overview

    Type
    Collection
    ...Sensing and Signaling Browse plasmids related to intercellular signaling and environmental sensing. Strains...
  9. Troubleshooting and Optimizing a Western Blot

    Type
    Blog Post
    ...check its subcellular location and solubility. If it’s membrane-bound or located in a subcellular compartment...reagent. Be aware that this approach requires excellent attention to detail, since you’ll end up with ...question before running one.  Good on gradients? Excellent! Now, let’s head west, intrepid reader! Protein...strengths. If that’s not working, consider using a subcellular fractionation kit or a lysing protocol developed...to see if one works better than another. For nitrocellose membranes, you can even give gelatin a shot....strength Sonication based lysing protocol Subcellular fractional kit or lysing protocol Not enough...
  10. Uncertainty about Labor Law Brings More Uncertainty to Postdoc Wages

    Type
    Blog Post
    ...expecting a salary increase have had that increase cancelled. Rounding out the remainder, 2% of postdocs who... are continuing with their plans, and 17 have cancelled their plans. 2 of those raising - the University...Illinois and the University of Michigan - initially cancelled their plans, but have since reversed their position... In addition, PIs at some of the institutions cancelling plans are going ahead with raises anyway, including...injunction, as we started to hear of institutions cancelling plans to raise salaries, the only postdocs we...
  11. Control AAV Preps

    Type
    Collection
    ...pAAV-CBh-mKate2-IRES-MCS (WT-WT) CBh mKate2 Constitutive 2 Marcella Patrick 114469 pAAV-CaMKIIa-mCherry CaMKIIa mCherry...
  12. Celebrating 15 Years of Scientific Sharing

    Type
    Blog Post
    ...teams continue to keep up with the demand with excellence and dedication. We don’t have worry or wonder...right? Upgrades to the internal LIMS pages and excellent work on our external website appearance and functionality...support. The Addgene management team leads with excellence. They are one of the main reasons I have so few...Addgenies. I never worry about their dedication, excellent intentions, or incredible drive to succeed.  Thanks...
  13. Developing Transferable Skills During Science Training

    Type
    Blog Post
    ...transferable skills while you are also learning to be an excellent scientist. Leadership and management Take a lead...supportive editors so your first drafts are always excellent Technical knowledge and creativity Become a “...local networking and trade organizations Another excellent perspective on this topic can be found on the ...
  14. 6 Steps to Submitting a Resume That Gets Seen

    Type
    Blog Post
    ...give you a chance at an interview:  1) Have an excellent resume ready to be submitted The structure and...successful application. It takes time to prepare an excellent resume…it is worth it. Read here to get help if...if you are having trouble preparing your most excellent resume. 2) Follow job boards and check them regularly...
  15. Experimenting with New Careers while in Grad School

    Type
    Blog Post
    ...is an excellent resource that has gained a lot of traction with researchers. It is an excellent way to...programs and departments Graduate school was an excellent time to try new things, develop new skills, and...
  16. Management for Scientists: Seeking Feedback

    Type
    Blog Post
    ...down to one, key concept: Creating a culture of excellent, effective communication between all members of...meetings with team members (don’t become known for cancelling these); ask for feedback and input on multiple...
  17. Choosing a Good Mentor for Scientists

    Type
    Blog Post
    ...reading Toxic Academic Mentors by @drmellivora, an excellent blog post about workplace bullying featured on...the first place. The good news There are many excellent mentors out there. With some good pre-work you...
  18. Clear and Accessible Writing

    Type
    Blog Post
    ...text for the example image. We’ll wait!  Done? Excellent! We asked our workshop participants to do the ...heard of alt text before, they all came up with excellent alt text for their practice image. We know; we...
  19. A Deep Dive into BioBuilder

    Type
    Blog Post
    ...of Professor Richard Murray. Murray’s lab uses cellular extracts to perform transcription and translation...develop and test hypotheses. Students then use cellular extracts as a means to rapidly prototype DNA circuits...
  20. Communicating Your Science With Help From ComSciCon

    Type
    Blog Post
    ...as an opportunity to practice communicating.  Excellent scientists learn from advisers and other mentors...help graduate students in all STEM fields become excellent science communicators. To empower graduate students...
  21. Career Coaching for Scientists: Why and Where Do I Find One?

    Type
    Blog Post
    ...Professional Career Coaching can be an excellent tactic for scientists making a career shift or who wish...Consulting is part of that group and she is especially excellent in coaching for communication skills. Industry...
  22. Tips for Writing a Good Cover Letter

    Type
    Blog Post
    ...of experience in [field of research], and have excellent [list the most important skills for the position... specific examples. Instead of saying “I have excellent communication skills” try giving an example, like...
  23. 5 Reasons to Use Reddit for Science Communication

    Type
    Blog Post
    ... training is abundant, helpful, and sometimes excellent. Finally, as I said in the AMA, it’s incredibly...topics to the Addgene blog The blog has many other excellent posts on science career topics as well. Instead...
  24. A History of Genome Engineering in Popular Culture

    Type
    Blog Post
    ... in the genome. These technologies rely on the cellular DNA repair machinery, which can lead to high frequency... C (2000) Hugo De Vries: from the theory of intracellular pangenesis to the rediscovery of Mendel. Comptes...
  25. The 12 Days of CRISPR: 2021

    Type
    Blog Post
    ... to me: Selective Endogenous eNcapsidation for cellular Delivery (SEND). On the fourth day of CRISPR, ...
  26. Deck the Lab 2022!

    Type
    Blog Post
    ...y34Tv8VCLT— Borris Aldonza (보리스) 🇰🇷🇵🇭 (@PrecursorCell) December 12, 2022          View this post...
  27. Newly Updated AAV Data Hub!

    Type
    Blog Post
    ...includes: Images that clearly show viral spread and cellular tropism* (min. 300 dpi, PNG format) At least two...
  28. Microbes: Look, Listen, and Tell

    Type
    Blog Post
    ... to microbes by using non-invasive methods for cellular imaging with ultrasound. In his research he applies...
  29. Antibodies 101: Affinity Tags

    Type
    Blog Post
    ...purification, it will be expressed along with all other cellular proteins within the expression system (bacteria...
Showing: 751 - 800 of 813 results