Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 444 results for: crispr

Showing: 301 - 320 of 444 results

  1. Bacterial Expression Systems

    Type
    Collection
    ...list of our bacterial CRISPR plasmids, see here . pwtCas9-bacteria 44250 CRISPR Stanley Qi Anhydrotetracycline... list of our bacterial CRISPR plasmids, see here . pgRNA-bacteria 44251 CRISPR Stanley Qi Expression of...alter bacterial genomes. From recombineering to CRISPR , this collection contains a variety of tools to...research. Plasmid ID Technique PI Purpose pCas9 42876 CRISPR Luciano Marraffini Bacterial expression of Cas9... For a more comprehensive list of our bacterial CRISPR plasmids, see here . pGRG Series Various Plasmids...

  2. Validated gRNA Sequences

    Type
    Collection
    ...Sequences You may also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The table below...PAM sequence). Which CRISPR application is this gRNA sequence compatible with? CRISPR knockout experiments... Genome Engineering CRISPR Validated gRNA Sequence Datatable Validated gRNA...that have been experimentally validated for use in CRISPR experiments. This datatable is compiled from plasmids...experiments use targeting sequences within exons, whereas CRISPR activation or repression experiments use targets...possible, the categories described on Addgene's CRISPR Plasmids and Resources page have been used to indicate...Church GLuc synthetic GATCTAGATACGACTCACTAT 68422 CRISPR-display S. pyogenes 26030444 Rinn gp78 H. sapiens...

  3. Viral Vectors 101: Integrase-Deficient Lentiviral Vectors

    Type
    Blog Post
    ...purposes, like creating stable cell lines, delivering CRISPR/Cas9 to cells for genome editing, and introducing... is gradually reduced. For example, after using CRISPR/Cas9 to edit a gene, the expression of Cas9 is ...High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nature Biotechnology...

  5. How Addgene Creates Content

    Type
    Blog Post
    ...knowledge changes and require updating or retiring. CRISPR/Cas9, for example, has gone through rapid change...Resources on the Addgene Blog Science careers Plasmids CRISPR Viral vectors Fluorescent proteins  ...

  6. Pushing the Limits of DNA Assembly

    Type
    Blog Post
    ...sgRNAs Generating constructs to produce sgRNA for CRISPR experiments can be laborious, requiring multiple... Addtional Resources on Addgene.org Browse Our CRISPR Resources Find Validated gRNAs Browse All Plasmids...

  7. AAV Q&A with Tim Miles

    Type
    Blog Post
    .... The continued development of more and smaller CRISPR tools is an exciting area for future AAV application...- a primer for beginners Adenoviral delivery of CRISPR/Cas9 Tips for a first time AAV user Resources ...

  8. Viral Vectors 101: Viral Applications

    Type
    Blog Post
    ...inducibly depending on the vector and virus. Viral CRISPR-Cas9 tools have been engineered to introduce frameshift...Discuss Gene Therapy with AAV Adenoviral Delivery of CRISPR/Cas9 Aims to Expand Genome Editing to Primary Cells...

  9. How to Keep a Lab Notebook for Bioinformatic Analyses

    Type
    Blog Post
    ...Save Time and Track Your Experiments Try out the CRISPR Software Matchmaker Additional Resources on Addgene.org...Protocols for Your Next Experiment Find Our List of CRISPR gRNA Design Tools ...

  15. Plasmids 101: Using Transposons in the Lab

    Type
    Blog Post
    ...encodes a Type I-F CRISPR-Cas system. This system has four major components: 1) a CRISPR RNA (crRNA), 2) ...sets the stage for combining the super powers of CRISPR and transposons to allow for the targeted delivery...

  16. Important Considerations When Using AAVs

    Type
    Blog Post
    ...system. Currently, AAVs are being used to deliver CRISPR/Cas9 but have the potential to deliver other therapeutic...be used with new exciting technologies (such as CRISPR/Cas9) as they allow for gene delivery in an efficient...Gene Expression in Mammals A Match Made in Heaven: CRISPR/Cas9 and AAV Viral Vector Elements Additional ...

  17. Quickest Way to Deposit Plasmids: The Deposit Spreadsheet

    Type
    Blog Post
    ... expression, plant expression, mouse targeting, CRISPR, TALEN, synthetic biology, affinity reagent/antibody...Plasmids Searchable and Sortable gRNAs for Your Next CRISPR Experiment Suggest A Plasmid You'd Like to Find...

  20. Plasmids 101: Degron Tags

    Type
    Blog Post
    ...several advantages over the alternative systems – CRISPR, siRNA, etc. Firstly, they are reversible mechanisms....1073/pnas.1216880109 Resources on Addgene.org CRISPR Plasmids – Protein Tagging CRISPaint Gene Tagging...
Showing: 301 - 320 of 444 results