We narrowed to 452 results for: crispr
-
TypeBlog Post...sgRNAs Generating constructs to produce sgRNA for CRISPR experiments can be laborious, requiring multiple... Addtional Resources on Addgene.org Browse Our CRISPR Resources Find Validated gRNAs Browse All Plasmids...
-
How Addgene Creates Content
TypeBlog Post...knowledge changes and require updating or retiring. CRISPR/Cas9, for example, has gone through rapid change...Resources on the Addgene Blog Science careers Plasmids CRISPR Viral vectors Fluorescent proteins ... -
AAV Q&A with Tim Miles
TypeBlog Post.... The continued development of more and smaller CRISPR tools is an exciting area for future AAV application...- a primer for beginners Adenoviral delivery of CRISPR/Cas9 Tips for a first time AAV user Resources ... -
Multiplexed Overexpression of Regulatory Factors (MORF) collection
TypeBlog Post....cell.2022.11.026 Joung J. et al., Genome-scale CRISPR Cas-9 knockout and transcriptional activation screening...Libraries Pooled library amplification Zhang Lab CRISPR Plasmids The Human TFome Library ... -
Viral Vectors 101: Viral Applications
TypeBlog Post...inducibly depending on the vector and virus. Viral CRISPR-Cas9 tools have been engineered to introduce frameshift...Discuss Gene Therapy with AAV Adenoviral Delivery of CRISPR/Cas9 Aims to Expand Genome Editing to Primary Cells... -
How to Keep a Lab Notebook for Bioinformatic Analyses
TypeBlog Post...Save Time and Track Your Experiments Try out the CRISPR Software Matchmaker Additional Resources on Addgene.org...Protocols for Your Next Experiment Find Our List of CRISPR gRNA Design Tools ... -
iPSC Neurodegenerative Disease Initiative Plasmid Collection
TypeCollection...Initiative (iNDI) Collection You May Also Like... CRISPR Guide CRISPR Protein Tagging Plasmids for Stem Cell Research... -
Supporting Rare Disease Research with the 2020 BeHEARD Awards
TypeBlog Post...happening within the keratinocytes. “We hope to use CRISPR libraries from Addgene to set up assays to see ... contraction defects. The lab also plans to use CRISPR plasmids to generate deletions of candidate genes... -
RaPID Detection of RNA-protein Interactions
TypeBlog Post...Split-BioID plasmids Find CRISPR plasmids for labeling genomic regions Find CRISPR plasmids for purifying... -
Hot Plasmids April 2018 - Protein Degradation, Nanoscopy, FIRE-Cas9, and Yeast Expression Tools
TypeBlog Post...Gearing Listen to the TRIM-Away podcast segment CRISPR and RNAi have helped researchers alter DNA sequence...Segment Jerry Crabtree’s lab has developed a new CRISPR/Cas9-based system to study epigenetic modulation... -
Enabling high school research at the Journal of Emerging Investigators
TypeBlog Post...teach students about basic plasmid biology Use or CRISPR 101 eBook to introduce students to this amazing... -
The Codon Guide to Synthetic Biology
TypeBlog Post...seminal” studies for various categories, including CRISPR gene-editing, the foundations of synthetic biology... -
Important Considerations When Using AAVs
TypeBlog Post...system. Currently, AAVs are being used to deliver CRISPR/Cas9 but have the potential to deliver other therapeutic...be used with new exciting technologies (such as CRISPR/Cas9) as they allow for gene delivery in an efficient...Gene Expression in Mammals A Match Made in Heaven: CRISPR/Cas9 and AAV Viral Vector Elements Additional ... -
Plasmids 101: Using Transposons in the Lab
TypeBlog Post...encodes a Type I-F CRISPR-Cas system. This system has four major components: 1) a CRISPR RNA (crRNA), 2) ...sets the stage for combining the super powers of CRISPR and transposons to allow for the targeted delivery... -
Distribution to Industry
TypeCollection...Mutation Libraries CRISPR Thorsten Stiewe Use these donor vector libraries for CRISPR/Cas9-mediated saturation...Fusions from Promega COVID-19 SARS-COV-2, ACE2, and CRISPR tools Fluorescent Proteins from the Michael Davidson... -
Validated gRNA Sequences
TypeCollection...Sequences You may also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The table below...PAM sequence). Which CRISPR application is this gRNA sequence compatible with? CRISPR knockout experiments... Genome Engineering CRISPR Validated gRNA Sequence Datatable Validated gRNA...that have been experimentally validated for use in CRISPR experiments. This datatable is compiled from plasmids...experiments use targeting sequences within exons, whereas CRISPR activation or repression experiments use targets...possible, the categories described on Addgene's CRISPR Plasmids and Resources page have been used to indicate...Church GLuc synthetic GATCTAGATACGACTCACTAT 68422 CRISPR-display S. pyogenes 26030444 Rinn gp78 H. sapiens... -
Quickest Way to Deposit Plasmids: The Deposit Spreadsheet
TypeBlog Post... expression, plant expression, mouse targeting, CRISPR, TALEN, synthetic biology, affinity reagent/antibody...Plasmids Searchable and Sortable gRNAs for Your Next CRISPR Experiment Suggest A Plasmid You'd Like to Find... -
Plasmids 101: In-house NGS Plasmid Quality Control Now at Addgene
TypeBlog Post... of the plasmid in the pool - ex. the gRNA in a CRISPR library. In general, our QC scientists work with...Brigham MD, Sanjana NE, Zhang F (2017) Genome-scale CRISPR-Cas9 knockout and transcriptional activation screening... -
Imaging Tools and Following a Passion for Basic Biology: Interview with Joachim Goεdhart
TypeBlog Post... crispr... -
Allen Institute for Cell Science Plasmid Collection
TypeCollection... Plasmid Collection You May Also Like... CRISPR Guide CRISPR Protein Tagging Fluorescent Protein Guide...Gunawardane, R. N. (2017). Systematic gene tagging using CRISPR/Cas9 in human stem cells to illuminate cell organization...