Skip to main content

We narrowed to 452 results for: crispr

Showing: 301 - 320 of 452 results
  1. Pushing the Limits of DNA Assembly

    Type
    Blog Post
    ...sgRNAs Generating constructs to produce sgRNA for CRISPR experiments can be laborious, requiring multiple... Addtional Resources on Addgene.org Browse Our CRISPR Resources Find Validated gRNAs Browse All Plasmids...
  2. How Addgene Creates Content

    Type
    Blog Post
    ...knowledge changes and require updating or retiring. CRISPR/Cas9, for example, has gone through rapid change...Resources on the Addgene Blog Science careers Plasmids CRISPR Viral vectors Fluorescent proteins  ...
  3. AAV Q&A with Tim Miles

    Type
    Blog Post
    .... The continued development of more and smaller CRISPR tools is an exciting area for future AAV application...- a primer for beginners Adenoviral delivery of CRISPR/Cas9 Tips for a first time AAV user Resources ...
  4. Viral Vectors 101: Viral Applications

    Type
    Blog Post
    ...inducibly depending on the vector and virus. Viral CRISPR-Cas9 tools have been engineered to introduce frameshift...Discuss Gene Therapy with AAV Adenoviral Delivery of CRISPR/Cas9 Aims to Expand Genome Editing to Primary Cells...
  5. How to Keep a Lab Notebook for Bioinformatic Analyses

    Type
    Blog Post
    ...Save Time and Track Your Experiments Try out the CRISPR Software Matchmaker Additional Resources on Addgene.org...Protocols for Your Next Experiment Find Our List of CRISPR gRNA Design Tools ...
  6. Important Considerations When Using AAVs

    Type
    Blog Post
    ...system. Currently, AAVs are being used to deliver CRISPR/Cas9 but have the potential to deliver other therapeutic...be used with new exciting technologies (such as CRISPR/Cas9) as they allow for gene delivery in an efficient...Gene Expression in Mammals A Match Made in Heaven: CRISPR/Cas9 and AAV Viral Vector Elements Additional ...
  7. Plasmids 101: Using Transposons in the Lab

    Type
    Blog Post
    ...encodes a Type I-F CRISPR-Cas system. This system has four major components: 1) a CRISPR RNA (crRNA), 2) ...sets the stage for combining the super powers of CRISPR and transposons to allow for the targeted delivery...
  8. Distribution to Industry

    Type
    Collection
    ...Mutation Libraries CRISPR Thorsten Stiewe Use these donor vector libraries for CRISPR/Cas9-mediated saturation...Fusions from Promega COVID-19 SARS-COV-2, ACE2, and CRISPR tools Fluorescent Proteins from the Michael Davidson...
  9. Validated gRNA Sequences

    Type
    Collection
    ...Sequences You may also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The table below...PAM sequence). Which CRISPR application is this gRNA sequence compatible with? CRISPR knockout experiments... Genome Engineering CRISPR Validated gRNA Sequence Datatable Validated gRNA...that have been experimentally validated for use in CRISPR experiments. This datatable is compiled from plasmids...experiments use targeting sequences within exons, whereas CRISPR activation or repression experiments use targets...possible, the categories described on Addgene's CRISPR Plasmids and Resources page have been used to indicate...Church GLuc synthetic GATCTAGATACGACTCACTAT 68422 CRISPR-display S. pyogenes 26030444 Rinn gp78 H. sapiens...
  10. Quickest Way to Deposit Plasmids: The Deposit Spreadsheet

    Type
    Blog Post
    ... expression, plant expression, mouse targeting, CRISPR, TALEN, synthetic biology, affinity reagent/antibody...Plasmids Searchable and Sortable gRNAs for Your Next CRISPR Experiment Suggest A Plasmid You'd Like to Find...
  11. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ... Plasmid Collection You May Also Like... CRISPR Guide CRISPR Protein Tagging Fluorescent Protein Guide...Gunawardane, R. N. (2017). Systematic gene tagging using CRISPR/Cas9 in human stem cells to illuminate cell organization...
Showing: 301 - 320 of 452 results