Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 509 results for: plasmid dna

Showing: 481 - 509 of 509 results

  1. CRISPR Guide

    Type
    Guide
    ...-stranded DNA (dsDNA) plasmid. Small single-stranded DNA (ssDNA) oligos often work well for small edits...purify specific regions of DNA, image DNA in live cells, and precisely edit DNA and RNA. The ease of generating...Browse Plasmids: RNA Targeting , RNA Editing Degrading DNA with Cas3 Rather than initiating DNA cleavage...homology with the target DNA. Once the Cas9-gRNA complex binds a putative DNA target, the seed sequence...will begin to anneal to the target DNA. If the seed and target DNA sequences match, the gRNA will continue...strands of the target DNA. This results in a double-strand break (DSB) within the target DNA, located ∼3–4 nucleotides...of target DNA. Cas9n increases target specificity. Since two nickases targeting opposite DNA strands are...

  2. Viral Vectors 101: Systemic Capsids

    Type
    Blog Post
    ...about that collection. Table 1: Systemic capsid plasmids available from Addgene Capsid Published ...-X1.1 showed the greatest fold change in RNA and DNA levels (~25-fold and ~4-fold respectively) relative...re interested in. Then request your capsid (or plasmids) and let the real work begin — validation, validation...

  3. Promoters

    Type
    Guide
    ...Expression Plasmids 101: The Promoter Region — Let's Go! Plasmids 101: Inducible Promoters Plasmids 101: Repressible...binding of the RNA polymerase to DNA. RNA polymerase transcribes DNA to mRNA, which is ultimately translated...that the DNA tends to fold back on itself, which helps to explain how many physically distant DNA sequences...Repressible Promoters Plasmids 101: Terminators and PolyA signals More Plasmids 101 topics Content last...Eukaryotic Promoters Resources A promoter is a region of DNA where transcription of a gene is initiated. Promoters...transcribed gene (Figure 1). The coding strand is the DNA strand that encodes codons and whose sequence corresponds...during transcription. Created with BioRender.com. DNA sequences called response elements are located within...

  4. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...different plasmid. In order to produce rAAV vectors, three plasmids are needed: Transfer plasmid (also known...the packaging plasmid. For a summary of all AAV plasmid components, see the AAV Plasmid Elements table...repeat DNA molecule that spontaneously reanneals upon infection, forming a double-stranded DNA (dsDNA) template...-stranded DNA genome. Adeno-associated viruses (AAV), however, are small single-stranded DNA viruses that...as cis plasmid) — containing the transgene of interest between the two ITRs. Packaging plasmid (also known...chosen plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be ... often results in a greater yield of DNA. However, if the plasmid contains a Gateway cassette containing...

  5. Adenovirus Guide

    Type
    Guide
    ...you generally need two plasmids: Shuttle plasmid (also known as transfer plasmid) — containing the transgene...shuttle plasmid. For a summary of all adenoviral plasmid components, see the Adenoviral Plasmid Elements...for viral DNA replication and host cell manipulation. Late transcripts are expressed after DNA replication...-stranded DNA genome. Adeno-associated viruses (AAV), however, are small single-stranded DNA viruses that...for recombination with the adenoviral plasmid. Adenoviral plasmid — containing the rest of the adenoviral...chosen plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be ... often results in a greater yield of DNA. However, if the plasmid contains a Gateway cassette containing...

  7. Modular Cloning Guide

    Type
    Guide
    ...You may also like... Plasmid Kits Blog: Plasmids 101 Modular Cloning Blog: Plasmids 101 Modular Cloning...Applications and Kits Blog: Plasmids 101 Golden Gate Cloning Synthetic Biology Plasmids Modular Cloning (or MoClo...for efficiently assembling multiple DNA parts into functional plasmids. It is a powerful and very efficient...recognition site, leaving DNA fragments with an overhang of 4 bp. If each DNA module is flanked with a ...Parrott 48 plasmids compatible with the GreenGate Cloning System (Lohmann) to create plasmids with multi-gene...Expression Tomáš Pluskal Plasmid kit for assembly of single-gene and multigene plasmids for genome integration... with plasmids from the MoClo-YTK . MoClo Pichia Toolkit Yeast Expression Volker Sieber Plasmids with ...

  8. Plan Your Experiment

    Type
    Guide
    ...design. Addgene offers many plasmids containing validated gRNAs . These plasmids contain gRNAs that have ...generate stable cell lines if your plasmid contains a selection marker. Plasmid delivery is versatile thanks...more than just the DNA sequence. If this is the case, you can confirm your edit using DNA-based methods like...Application Cas Enzyme Additional Considerations Browse Plasmids Knockout Permanently disrupt gene function; cells...mutations or small tag insertions, by copying from a DNA donor template Cas9 or Cas9 fusions with proteins...different activator systems exist, including the multi-plasmid SAM system Activate Design and Clone Your gRNA ...efficiency . Remember that HDR also requires donor DNA to serve as template for the repair. Once you settle...

  9. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...Gamma-Retroviral Plasmid Elements Plasmid Type Element Delivery relative to transgene Purpose Transfer plasmid LTR ...transcribed into DNA before being integrated in the genome of a host. Going from RNA to DNA is the reverse... of all gamma-retroviral plasmid components, see the Gamma-Retroviral Plasmid Elements table . In order...gamma-retroviral vectors, you need three plasmids (Figure 2): Transfer plasmid — contains transgene, sgRNA, or ...capacity Packaging plasmid — contains packaging genes gag and pol Envelope plasmid — contains packaging...chosen plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be ... often results in a greater yield of DNA. However, if the plasmid contains a Gateway cassette containing...

  10. Lentiviral Vector Guide

    Type
    Guide
    ...second-generation transfer plasmids as well. Third-generation plasmids include (Figure 4): Transfer plasmid — contains...Packaging plasmid 1 — contains gag and pol Packaging plasmid 2 — contains rev Envelope plasmid — contains...systems Packaging Plasmid One plasmid encoding gag , pol , tat , and rev Two plasmids, one encoding gag...Lentiviral Plasmid Elements Plasmid Type Element Delivery relative to transgene Purpose Transfer plasmid LTR ...transcribed into DNA before being integrated in the genome of a host. Going from RNA to DNA is the reverse...separated into distinct plasmids for safety. For a summary of all lentiviral plasmid components, see the ...four, for third generation) plasmids: Transfer plasmid — contains transgene, sgRNA, or shRNA of interest ...

  11. Guide to Using Pooled Libraries

    Type
    Guide
    ... In cDNA libraries, each plasmid contains a unique cDNA. In shRNA or gRNA libraries, each plasmid contains... Science Guides Guide to Plasmid Pooled Libraries Plasmid Pooled Libraries Jump To: Pooled Library...are single preparations of many different plasmids. Plasmids within a given library have the same backbone...protocol for the best results. For some libraries, plasmid DNA can be delivered directly to the cells of interest... others, notably pooled lentiviral plasmid libraries, the plasmids must first be used to make virus. This...infected cell receives only one plasmid. To make sure that every plasmid is adequately represented in the... given plasmid, think of each cell carrying it as being a biological replicate for that plasmid. Library...

  12. Antibody Guide

    Type
    Guide
    ...little variation. Recombinant plasmids - Antibodies can be produced from plasmids, with an antibody’s genetic... genes from specific hybridoma cells into plasmids. Plasmids are then transfected into cells and induced...interactions between DNA and protein. Micrococcal nuclease digestion is used to shear the DNA in these assays... uses antibodies to capture protein:DNA complexes. After capture, the DNA is released from the complex...suitable for DNA:histone modifier interactions, which have strong binding between the protein and DNA. Some ...immune cells, or through the use of recombinant plasmids. Animals - Antibodies produced in animals make...genetic code inserted into the plasmid. This produces the least amount of variation between antibodies, allows...

  13. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ... on the plasmid. gRNA plasmids that do not co-express a Cas protein require a separate plasmid that does...gRNA Vectors CRISPR Plasmids: Empty gRNA Expression Vectors Browse CRISPR Plasmids By Function Genome ... these independent gRNA plasmids can be paired with a wide variety of plasmids and therefore are not limited.... Whether the plasmid contains Cas9 and if so, which function of Cas9. We have plasmids with Cas9 that...none, need plasmid 65775 N. meningitidis Joung VVT1 65779 Mammalian BsmBI none, need plasmid 65776 S. aureus...expression of Csy4 (eg Plasmid 53369 ). Joung pX333 Mammalian Single all-in-one plasmid for tandem expression...types of plasmids available for use in this Golden Gate and Gateway based assembly method: plasmids for assembly...

  14. Sequencing Primers

    Type
    Guide
    ...additional information on molecular biology, plasmids, and recombinant DNA, please consult Addgene's Molecular ...mainly uses next-generation sequencing (NGS) for plasmid verification, Addgene has used a number of primers...useful in your sequencing reaction, find your plasmid’s page and see what primers are listed under "5'...questions about choosing the best primer for your plasmid? Email us at [email protected] . For additional ...Forward Gal4 N-term GAGTAGTAACAAAGGTCAA 3' end of Gal4 DNA binding domain Forward Gal4-AD AATACCACTACAATGGAT...Reverse LexA CGTCAGCAGAGCTTCACCATTG 3' end of LexA DNA binding domain Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT...GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids Forward pCasper-F GGGTTTTATTAACTTACAT 5' end of...

  15. Optogenetics Guide

    Type
    Guide
    ... check out our Biosensors Plasmid Collection . To find optogenetics plasmids available through Addgene...mutagenesis - use Addgene's Optical Switch Plasmid Table to search for plasmids for your next experiment. For a ...domain (iLID plasmid), while its natural binding partner SspB is included in a separate plasmid; Blue light...Addgene's guide to using Optogenetics plasmids in your lab, including explanations of microbial opsin...Addgene, check out our Optogenetics Plasmid Collection . Microbial Opsins Opsins are light-gated ion channels... of opsins here to find the right optogenetics plasmids for your experiments. Channelrhodopsins Channelrhodopsins...SwiChRca, Phobos, Aurora Browse Channelrhodospin plasmids . Halorhodopsins Halorhodopsins are light-gated...

  16. Arf GTPase Family

    Type
    Collection
    ... Richard Kahn Lab Plasmids GTPase Plasmids GAP and GEF Plasmids References The ARF (ADP-ribosylation factor...examples of plasmid types available for each gene. Click the gene name for a full list of plasmids available...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...ARF family plasmids. ARF family members include regulatory GTPases, GEFs, and GAPs. Plasmid... Plasmid Collections...Collections ARF Superfamily Plasmids for ARF Superfamily Research You may also like... RAS Clone Collections Richard...

  17. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Neveu Lab MXS Chaining Kit Luciferase Plasmid Collection Promega Plasmid Collection Reading and Resources ...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail... Maturation Structure Plasmids EYFP 513 527 51 6.9 Prone to dimerization pcDNA3-YFP - Mammalian Expression...Maturation Structure Plasmids Dendra2 490 553 507 573 405 23 19 6.6 6.9 Monomer pcDNA3.1 Dendra2 - Mammalian...Explore empty plasmid backbones with different fluorescent tags to create fusion proteins with your gene... Plasmid Collections Fluorescent Proteins Empty Backbones Fluorescent Proteins: Empty...Emission (nm) Brightness pKa Maturation Structure Plasmids Sirius 355 424 4 3.0 Prone to dimerization Sirius-N1...

  18. Lentivirus Plasmids

    Type
    Collection
    ... Viral Plasmids Lentiviral Plasmids Lentiviral Plasmids Transfer Plasmids Packaging ...Packaging Plasmids Envelope Plasmids Resources Lentiviruses, a subset of retroviruses, are some of the most common...(a virion) are divided among multiple plasmids: Transfer plasmid — contains transgene, sgRNA, or shRNA...flanked by LTRs Packaging plasmid — contains packaging and regulatory genes; one plasmid in second-generation...second-generation, two plasmids in third-generation Envelope plasmid — contains packaging gene env This collection highlights...Guide Popular Lentiviral Transfer Plasmids Looking for lentiviral plasmids to express a CRISPR gRNA? Browse...catalog for lentiviral CRISPR plasmids for gRNA expression . ID Plasmid Generation Description PI 8453...

  19. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Neurodegeneration Neurodegeneration Plasmids Neurodegeneration Plasmid Collection Addgene has a large collection...Meyer 114193 pc DNA FRT TO- APP695 APP CMV Alzheimer's Aleksandra Radenovic 114194 pc DNA FRT TO- APPSwed...Browse all Neurodegeneration Plasmids Do you have suggestions for other plasmids that should be added to this...Trimmer 197107 iYFP-Parkin Plasmid PRKN YFP TRE Parkinson's Dori Woods 197146 pcDNA3-ApoE2 APOE CMV Alzheimer's...Browse neurodegeneration plasmids for research related to Alzheimer's Disease, ALS, Frontotemporal Dementia...collection of neurodegeneration plasmids for research related to Alzheimer's Disease (AD), Amyotrophic...others. The table below can be sorted by disease, plasmid type, mutations, and/or tags such as fluorescent...

  20. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...Find plasmids encoding fluorescent fusion proteins with known subcellular localization patterns for colocalization... Plasmid Collections Fluorescent Proteins Subcellular Localization...your protein to a red fluorescent protein (find plasmids for cloning in our Fluorescent Proteins Empty ...general cellular organelles and structures. ID Plasmid Structure Targeting Gene/Signal Fluorescent Protein...below to find markers of cytoskeletal element. ID Plasmid Structure Targeting Gene/Signal Fluorescent Protein...below to find markers for cellular junctions. ID Plasmid Structure Targeting Gene/Signal Fluorescent Protein...

  21. Fluorescent Proteins: FRET

    Type
    Collection
    ...backbones and control plasmids. Donor Acceptor λ Dex QY D λ Aem ε A QY A R 0 J(λ) Plasmids mTagBFP sfGFP 399.... Browse Addgene's Luciferase Plasmid Collection or the Promega Plasmid Collection to find related tools...Find plasmids and resources for FRET experiments to measure protein interactions or conformation changes... Plasmid Collections Fluorescent Proteins FRET Fluorescent Proteins: FRET FRET Pairs FRET Calibration...FRET on our blog and explore the tables below for plasmids and information to help plan your next FRET experiment...The articles or collections listed below feature plasmids with positive and negative FRET controls or calibration... the cpFRET kit from the Pertz Lab or the 2in1 Plasmid Toolkit from the Grefen Lab. FRET pairs and biosensors...

  22. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...NeuroMab/Trimmer Lab Plasmid Collection R-mAb Plasmids scFv Plasmids Nanobody Plasmids Protocols References... Antibody Plasmid Collection NeuroMab Plasmid Collection... the plasmid, followed by the SV40 polyA tail (SV40 pA). Recombinant Monoclonal Antibody Plasmid Collection...following plasmids can be used to produce R-mAbs from transfected mammalian cells. Addgene ID Plasmid Target...partner labs. Learn More scFv Plasmid Collection The following plasmids can be used to produce scFvs from... Pan-GRK Mouse Mouse Nanobody Plasmid Collection The following plasmids can be used to produce nanobodies...research. Find plasmids encoding these R-mAbs here. Antibody...

  23. Fluorescent Protein Guide: In Vivo Imaging

    Type
    Collection
    ...Excitation/Emission Brightness Plasmids mCardinal 604/659 18 mCardinal plasmids from Chu et al. (2014) mNeptune...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...Find plasmids for in vivo imaging using far red, near-infrared, and photoactivatable fluorescent proteins... Plasmid Collections Fluorescent Proteins In Vivo Imaging Fluorescent Proteins: In Vivo Imaging...imaging is a powerful tool used to study individual plasmids or protein-protein interactions in deep-tissue...Protein Excitation/Emission Brightness Plasmids iRFP670 643/670 12.7 piRFP670-N1 miRFP670 642/670 12 pmiRFP670...Photoactivatable Protein Excitation/Emission Brightness Plasmids PAiRFP1 690/717 (after photoactivation) 3.2 pPAiRFP1...

  24. Plasmid Collections

    Type
    Collection
    ...Homepage Plasmid Collections Addgene Plasmid Collections Addgene's repository contains 165,108 plasmids . We've...you are looking for a non-plasmid item, browse our entire repository . Plasmid Resources Our curated resources...resources group plasmids together based on type or application. Browse our guides to find the plasmids and science...Viral Plasmids Lentivirus Adeno-associated Virus (AAV) γ-Retrovirus Adenovirus All Viral Plasmids Curated...Consortium Krüppel-like factors (KLF) Plasmid Resource RESOLUTE Plasmid Collection for Solute Carrier Proteins... Find deposited plasmids for specific disease research areas. Cancer Research Plasmids and Resource Michael... Syndrome Plasmid Collection and Resource Center Do you have suggestions for other plasmids that should...

  25. CRISPR Plasmids - gRNAs

    Type
    Collection
    ... CRISPR gRNAs CRISPR Plasmids: gRNAs Browse CRISPR Plasmids By Function Genome Editing Cut ... any of these gRNA plasmids and review the publication associated with each plasmid for more information...information on the experimental use of these plasmids. ID Plasmid Gene/Insert Vector Type PI Publication Do...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...and more, created and maintained by the Doudna Lab . gRNA Plasmids Please note that the following table ...Tools CRISPR Blog Posts The table below lists gRNA plasmids designed to target various genes or genomic regions...here to start the deposit process and have your plasmids added to the list. You can also email [email protected]...

  26. Cancer Research Plasmids and Resources

    Type
    Collection
    ...component to find plasmids with your gene of interest. Browse Cancer Research Plasmids by Pathway mTOR ...Addgene's curated collection of plasmids for cancer research, organized by signaling pathway. Special...Special Collections Cancer Research Cancer Research Plasmids and Resources Addgene has a large variety of resources...Each collection page listed below organizes the plasmids and resources by signaling pathway, focusing on...Libraries for Cancer Research Broad Target Accelerator Plasmids: Collection of vectors from the Boehm , Hahn ,...vectors from the Sabatini & Wood Labs containing cDNAs for studying oncogenic signaling pathways. ClonTracer...

  27. Retrovirus Plasmids

    Type
    Collection
    ...Gamma-Retroviral Plasmids Gamma-Retroviral Plasmids Transfer Plasmids Packaging Plasmids Envelope Plasmids Additional...transfer plasmids that have inserts. ID Plasmid 5'LTR Description PI 1780 pBABE-neo largeTcDNA MoMLV Expression...retroviral plasmids at Addgene, including popular packaging, envelope, and transfer plasmids. Viral...particles have been split into multiple plasmids for safety: Transfer plasmid — contains transgene, sgRNA, or ...flanked by LTRs Packaging plasmid — contains packaging genes Envelope plasmid — contains packaging gene...Popular Gamma-Retroviral Transfer Plasmids Want a retroviral plasmid with your gene of interest? Search...of immortalized cells. See plasmid 1771 for puromycin selection, and plasmid 1774 for neomycin selection...

  28. CRISPR Plasmids - Tagging

    Type
    Collection
    ...and Myers Tagging Plasmids Protein Species Tag Donor Plasmid gRNA plasmid gRNA plasmid FLAG pFETCh_Donor.... Multiple gRNA plasmids may be used. The HDR (homology directed repair) donor plasmid with homology arms...individual tagging event. The kit contains 26 plasmids; 21 of the plasmids are for use in SapTrap reactions for...the remaining 5 plasmids include Cre and FLP expression vectors, a general cloning plasmid, and a prebuilt...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...CRISPR plasmids for endogenous tagging of your gene of interest. CRISPR...Plasmids - Protein Tagging Browse CRISPR Plasmids By Function Genome Editing Cut Base Edit Nick Prime Edit...

  29. Immunology Research Plasmids and Resources

    Type
    Collection
    ... Plasmid Collections Immunology Research Immunology Research Plasmids and Resources You...Fluorescent Proteins Cancer Research Plasmids Gene Categories Plasmid Tables Additional Resources Mammalian...to the available plasmids for each gene. Please note that not all genes have plasmids available for request...and apoptosis. Plasmid Tables The gene names in these tables link to the available plasmids for each gene...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...Addgene’s immunology collection contains plasmids for genes involved in innate and adaptive immune signaling...rapidly initiate a secondary immune response. Browse Plasmids for Immunology Research Genes have been grouped...
Showing: 481 - 509 of 509 results