We narrowed to 402 results for: Mut
-
TypeCollection...truncated at both the N and C terminus and induces mutation at rates much higher than the parental vectors...generation architecture has been shown to increase mutation induction when using TALENs. The FokI domains ...homodimeric or enhanced heterodimeric (ELD, KKR mutations) FokI domains. 40131 pCAG-T7-TALEN(Sangamo)-FokI-KKR-Destination... has successfully been employed for deletion mutagenesis and gene targeting in human and mouse pluripotent...suitable for the TALEN-based generation of germline mutations in Bombyx mori and Drosophila melanogaster . Zhang...
-
CRISPR Plasmids - Yeast
TypeCollection... create A->G (or T->C on the opposite strand) mutations. ID Plasmid Gene/Insert Promoter Selectable Marker...Marker PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in ...created by wild type Cas enzymes. To use a nickase mutant, you will need two gRNAs that target opposite strands...strategies reduce unwanted off-target effects. Nickase mutants can also be used with a repair template to introduce... -
CRISPR Plasmids - Bacteria
TypeCollection...opposite strand) mutations. ID Plasmid Promoter PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted...created by wild type Cas enzymes. To use a nickase mutant, you will need two gRNAs that target opposite strands...strategies reduce unwanted off-target effects. Nickase mutants can also be used with a repair template to introduce... -
CRISPR Plasmids - Plants
TypeCollection... create A->G (or T->C on the opposite strand) mutations. ID Plasmid Gene/Insert Promoter Selectable Marker...Marker PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in ...created by wild type Cas enzymes. To use a nickase mutant, you will need two gRNAs that target opposite strands...strategies reduce unwanted off-target effects. Nickase mutants can also be used with a repair template to introduce... -
Neurodegeneration Research Collection
TypeCollection...dominant manner, are associated with known genetic mutations in one of the following genes: SOD1, C9ORF72, ... huntingtin (HTT) gene. An individual with the mutated HTT gene will have huntingtin proteins with abnormally...-onset forms, a fraction of these are due to a mutation in one of three different inherited genes: Presenilin... collection of plasmids expressing wild type or mutant ORFs, gene fragments, and gRNAs for genes linked... -
CRISPR History and Development for Genome Engineering
TypeCollection...precise gene editing. These edits can include mutations seen in human patients, protein tags, or loxP/...editing rates. Advances in this area include: Nickase mutant: cuts only one strand of DNA and can be used with...off-target activity due to rationally designed mutations. Researchers have expanded the CRISPR field beyond...to be used together. Researchers have engineered mutant Cas enzymes with alternative PAM sites . Cpf1 ,... -
Tetracycline Inducible Expression
TypeCollection...tetracycline-controlled transactivator (fusion of mutated TetR with VP16 transcriptional activation domain... (Tet-On) In 1995, Gossen et al. used random mutagenesis to identify the amino acid residues of TetR that...important for tetracycline-dependent repression. Mutating these residues led to a reverse Tet repressor,...tetracycline-dependent transcriptional activators: novel mutations yield expanded range and sensitivity . Proc Natl... -
CRISPR Plasmids - Single-Strand Break (Nick)
TypeCollection...Design Tools CRISPR Blog Posts CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in...created by wild type Cas enzymes. To use a nickase mutant, you will need two gRNAs that target opposite strands...strategies reduce unwanted off-target effects. Nickase mutants can also be used with a repair template to introduce... -
CRISPR Plasmids - Drosophila
TypeCollection...Promoter PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in...created by wild type Cas enzymes. To use a nickase mutant, you will need two gRNAs that target opposite strands...strategies reduce unwanted off-target effects. Nickase mutants can also be used with a repair template to introduce... -
Cre-Lox and Other Site-Specific Recombinases
TypeCollection...different types of target sites available, both mutant and wild type. The ability to manipulate the number...Recombinase-mediated cassette exchange (RMCE): When matching but mutually incompatible recognition sites flank both a DNA...experimental results. Attenuated iCre(R297T), a point mutant iCre variant, reduces the number of recombination... -
Luciferase Plasmid Collection
TypeCollection...Firefly Insertion of 5' promoter/enhancer regions. Mutations within the luciferase gene allow for increased...Renilla CMV Mammalian expression Renilla luciferase mutant Rluc8, which has increased stability and light ...luciferases : A set of three increasingly destabilized mutants which serve as sensors of proteome stress. pHLuc... -
Zhang Lab CRISPR Page
TypeCollection...loss-of-function mutations in p53 and Lkb1 , as well as homology directed repair-mediated Kras G12D mutations, leading...KRAS , p53 and LKB1 , the top three significantly mutated genes in lung adenocarcinoma. Delivery of a single... -
Fluorescent Protein Guide: Biosensors
TypeCollection...construct leads to a change in signal of a circularly permuted fluorescent protein (cpFP) or fluorescence resonance...Yasushi Okada ATP (extracellular) GRAB_ATP1.0/ATP1.0mut biosensor for extracellular ATP (Constitutive ...1147-1155. Lin Tian Endocannabinoid GRAB_eCB2.0/eCBmut biosensor for endocannabinoids in vivo (Constitutive...pHluorin2 for pH sensing The zebrafish merovingian mutant reveals a role for pH regulation in hair cell toxicity... -
Validated gRNA Sequences
TypeCollection...elegans CGCTACCATAGGCACCACG 71516 cut VRER Cas9 mutant 26680661 Fire dpy-10 C.elegans GCTACCATAGGCACCACGAG...CGGAGCTGATCACTGACA 72890 cut S. pyogenes 26429889 Katsanis GFPmut3b A. victoria ACCATCTAATTCAACAAGAATT 73221 interfere... 72628 cut S. pyogenes 26493208 Guigo, Johnson GFPmut3b synthetic ACCATCTAATTCAACAAGAATT 73224 interfere... -
CRISPR Guide
TypeGuide...developed by mutating specific amino acid residues to reduce off-target editing. Some mutations disrupt interactions...off-target mutations in DNA, RNA, or both, and are recommended in contexts where such mutations would be... and a gRNA will result in a diverse array of mutations (see: Validate genetic modification ). In most...amino acid deletions, insertions, or frameshift mutations leading to premature stop codons within the open...targeted gene. The ideal result is a loss-of-function mutation within the targeted gene. However, the strength...strength of the knockout phenotype for a given mutant cell must be validated experimentally. Browse Plasmids...(nick) or no cuts. Cas9 nickase (Cas9n), a D10A mutant of SpCas9, has one active nuclease domain and one... -
Ginkgo Bioworks COVID-19 Collection
TypeCollection...SUMO, GST, MBP, CBP, S-tag, TAP tag, TRX, or V5) Mutations Wild type (wt) Codon-optimized expression (recode...making pseudovirus (Ctrunc) ID Plasmid Description Mutations Tags Industry Additional Addgene Resources Blog... -
CRISPR Plasmids - Base Edit
TypeCollection...spectrum of single-nucleotide variants (somatic hypermutation) in a wider editing window, and are thus well...editing systems include targeted AID-mediated mutagenesis (TAM) from the Chang lab and CRISPR-X from the... -
Zinc Finger Consortium: Zinc Finger Arrays
TypeCollection...ZFNs) are effective tools for making targeted mutations in zebrafish. With support from the NIH and guidance...):1471-1501. PubMed PMID 19798082 . Targeted mutagenesis in zebrafish using customized zinc-finger nucleases... -
AAV Molecular Tools
TypeCollection...-mPCSK9 hAAT-driven, constitutive Expression of mutant (D377Y) murine PCSK9 for studying hypercholesterolemia... microtubule-associated protein tau with P301L mutation 1 Tsuneya Ikezu Anterograde Transsynaptic Tracers... -
Adeno-associated virus (AAV) Plasmids
TypeCollection...name, capsid, and more. ID Plasmid Gene/Insert Mutations PI AAV Plasmids This table contains a general .... ID Plasmid Gene/Insert Vector Type Backbone Mutations Tags PI Do you have suggestions for other plasmids...