... create A->G (or T->C on the opposite strand) mutations. ID Plasmid Gene/Insert Promoter Selectable Marker...Marker PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in ...created by wild type Cas enzymes. To use a nickase mutant, you will need two gRNAs that target opposite strands...strategies reduce unwanted off-target effects. Nickase mutants can also be used with a repair template to introduce...

...opposite strand) mutations. ID Plasmid Promoter PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted...created by wild type Cas enzymes. To use a nickase mutant, you will need two gRNAs that target opposite strands...strategies reduce unwanted off-target effects. Nickase mutants can also be used with a repair template to introduce...

... create A->G (or T->C on the opposite strand) mutations. ID Plasmid Gene/Insert Promoter Selectable Marker...Marker PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in ...created by wild type Cas enzymes. To use a nickase mutant, you will need two gRNAs that target opposite strands...strategies reduce unwanted off-target effects. Nickase mutants can also be used with a repair template to introduce...

...dominant manner, are associated with known genetic mutations in one of the following genes: SOD1, C9ORF72, ... huntingtin (HTT) gene. An individual with the mutated HTT gene will have huntingtin proteins with abnormally...-onset forms, a fraction of these are due to a mutation in one of three different inherited genes: Presenilin... collection of plasmids expressing wild type or mutant ORFs, gene fragments, and gRNAs for genes linked...

... gene function as well as identify changes or mutations that may cause certain diseases. Sequencing DNA...

...precise gene editing. These edits can include mutations seen in human patients, protein tags, or loxP/...editing rates. Advances in this area include: Nickase mutant: cuts only one strand of DNA and can be used with...off-target activity due to rationally designed mutations. Researchers have expanded the CRISPR field beyond...to be used together. Researchers have engineered mutant Cas enzymes with alternative PAM sites . Cpf1 ,...

...Design Tools CRISPR Blog Posts CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in...created by wild type Cas enzymes. To use a nickase mutant, you will need two gRNAs that target opposite strands...strategies reduce unwanted off-target effects. Nickase mutants can also be used with a repair template to introduce...

...Promoter PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in...created by wild type Cas enzymes. To use a nickase mutant, you will need two gRNAs that target opposite strands...strategies reduce unwanted off-target effects. Nickase mutants can also be used with a repair template to introduce...

...Izaurralde 147272 pAc5.1B-lambdaN-HA-DmeIF4Ga-4Ebind-mut-dsRNAres_Q EIF4G His, HA, V5 Ac5 Parkinson's Elisa...17798 pM-ErbB4CTF-PY1 mutant ERBB4 GAL4-BD ALS Marius Sudol 17799 pM-ErbB4CTF-PY3 mutant ERBB4 GAL4-BD ALS...delta-kinase-PY1 mutant ERBB4 GAL4-BD ALS Marius Sudol 17802 pM-ErbB4-delta-kinase-PY3 mutant ERBB4 GAL4-BD...below can be sorted by disease, plasmid type, mutations, and/or tags such as fluorescent protein (FP) ...Disease Parkinson's Disease Others Gene Type Wildtype Mutant Partial Sequence Codon-Optimized gRNA Other Tags... YFP GAL1 ALS Aaron Gitler 29608 426Gal-FUS-RRM Mutant-YFP FUS YFP GAL1 ALS Aaron Gitler 29609 pcDNA 3.2...TMEM106B_Halo_C_allele TMEM106B Halo Frontotemporal dementia in GRN mutation carriers Michael Ward 178174 VAPB_Halo_C_allele...

... and quantify the efficiency of the targeted mutagenesis The amplicon sequence expected after HDR can ...cleavage position to the position of the observed mutations. Coding sequence/s may be provided to quantify...quantify frameshift and potential splice site mutations. The CRISPResso suite accommodates single or pooled ...

...loss-of-function mutations in p53 and Lkb1 , as well as homology directed repair-mediated Kras G12D mutations, leading...KRAS , p53 and LKB1 , the top three significantly mutated genes in lung adenocarcinoma. Delivery of a single...

...construct leads to a change in signal of a circularly permuted fluorescent protein (cpFP) or Förster resonance...Yasushi Okada ATP (extracellular) GRAB_ATP1.0/ATP1.0mut biosensor for extracellular ATP (Constitutive ...1147-1155. Lin Tian Endocannabinoid GRAB_eCB2.0/eCBmut biosensor for endocannabinoids in vivo (Constitutive...pHluorin2 for pH sensing The zebrafish merovingian mutant reveals a role for pH regulation in hair cell toxicity...

...elegans CGCTACCATAGGCACCACG 71516 cut VRER Cas9 mutant 26680661 Fire dpy-10 C.elegans GCTACCATAGGCACCACGAG...CGGAGCTGATCACTGACA 72890 cut S. pyogenes 26429889 Katsanis GFPmut3b A. victoria ACCATCTAATTCAACAAGAATT 73221 interfere... 72628 cut S. pyogenes 26493208 Guigo, Johnson GFPmut3b synthetic ACCATCTAATTCAACAAGAATT 73224 interfere...

...SUMO, GST, MBP, CBP, S-tag, TAP tag, TRX, or V5) Mutations Wild type (wt) Codon-optimized expression (recode...making pseudovirus (Ctrunc) ID Plasmid Description Mutations Tags Industry Additional Resources Read Addgene's...

...spectrum of single-nucleotide variants (somatic hypermutation) in a wider editing window, and are thus well...editing systems include targeted AID-mediated mutagenesis (TAM) from the Chang lab and CRISPR-X from the...

...ZFNs) are effective tools for making targeted mutations in zebrafish. With support from the NIH and guidance...):1471-1501. PubMed PMID 19798082 . Targeted mutagenesis in zebrafish using customized zinc-finger nucleases...

...name, capsid, and more. ID Plasmid Gene/Insert Mutations PI AAV Plasmids This table contains a general .... ID Plasmid Gene/Insert Vector Type Backbone Mutations Tags PI Do you have suggestions for other plasmids...

...applying the wild-type CRISPR system for genome mutagenesis ( Cong et al. , Mali et al. , Jiang et al. , ... Hwang et al. ), is that the nuclease-deficient mutant could silence transcription on the gene expression...

...(Link opens in a new window) for Targeted Gene Mutation in Rice - Yinong Yang. The MoClo CRISPR/Cas Toolkit...assembly for fast generation of multiple Arabidopsis mutants - Niko Geldner. CRISPR-Cas9 vector with GRF4-GIF1...

...Keith Joung Lab CRISPR/Cas9-based conditional mutagenesis in zebrafish - Wenbiao Chen Lab A CRISPR/Cas9... typically relies on genetic markers, somatic mutations, or labeling with fluorescent proteins to visualize...