Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 563 results for: cat.3

Showing: 341 - 360 of 563 results

  1. The Blue Flame Award: Celebrating Addgene's Most Requested Depositors

    Type
    Blog Post
    ...plasmids are categorized into a 3-level system on our website:   A yellow flame indicates that a plasmid...re proud to honor the creativity, passion, and dedication to sharing epitomized by the creators of these...Since we so sincerely appreciate our depositor’s dedication to scientific sharing, we wanted to celebrate...

  2. SunTag and Fluorescent Imaging

    Type
    Blog Post
    ...system for signal amplification in gene expression and fluorescence imaging.” Cell 159(3) (2014):635-46....aggregation, it’s recommended for most imaging applications. What can you do with SunTag? Tanenbaum et al...activation of target genes, but we’ll save that application for another day! References 1. Tanenbaum, Marvin...

  3. Addgene is Expanding Our Viral Vector Service!

    Type
    Blog Post
    ... 6–8 weeks Average shipping time: 1–2 days (USA); 3–4 days (international; varies widely by country and...request is approved, you will receive an email notification that your request is ready to order. An “Add...subscribe to the Addgene blog for updates and educational resources.  We hope you’re as excited about this...

  4. IBEX Knowledge-Base: A Data Resource for Multiplex Tissue Imaging

    Type
    Blog Post
    ...with others in the IBEX community.   Figure 3: Screenshot showing recent topics in the IBEX discussion...something doesn’t work, it’s not a failure. It’s an education.   Figure 4: Zenodo page showing the IBEX... repository for reagents, protocols, panels, publications, software, and datasets. It’s also a great place...

  5. A Better Way to Get Customer Support: The Help Center

    Type
    Blog Post
    ...it doesn’t help much if the actual response takes 3 days and still doesn’t even answer your question. ...right ones, quickly, and this is why we have a dedicated support team that can help you through any search...webpage, you can browse through our various FAQ categories or search through the entire FAQ collection. ...

  6. Cre-ating New Methods for Site-specific Recombination in Drosophila

    Type
    Blog Post
    ... cells, as well as in cortical neurons in layer 2/3 of the mouse brain. Rubin’s work shows that the yeast...Gerald Rubin’s lab sought to make complex genome modifications in Drosophila using multiple recombinases. To...offspring carried both the recombinase and GAL4, indicating that the recombinases were inherited normally...

  7. 9 tips for a successful postdoctoral experience

    Type
    Blog Post
    ...project. Furthermore, Group Leader position applications require 3 letters of reference- the graduate school...yourself to and talk with more senior scientists. 3. Work intensely, but intelligently Before you do your...need? Multiple first or corresponding author publications (published, not in preparation) A history of...The other items will follow. If you get more publications, you will be more competitive for fellowships...to write as well as mentor. Yet, even the most dedicated mentor is not always available for mentees due...interests, complementary perspectives, a shared communication style. You “get” each other. The other factor...makes time for you, as needed, this is a strong indicator that this person cares about your science and ...

  8. Viral Vectors 101: Optogenetic Tools

    Type
    Blog Post
    ...signaling pathway is unknown.      Figure 3: Chimeric OptoXR incorporating rhodopsin undergoes...Ultrafast optogenetic control. Nature Neuroscience, 13(3), 387–392. https://doi.org/10.1038/nn.2495 Marshel...channelrhodopsin-2 (ChR2), a blue light-activated cation channel, from the archaebacteria Chlamydomonas ...stimulation. GPCR signaling GPCR signaling is a complicated process involving many downstream signaling mechanisms...break your experiments!  First, closely read the publication, including the supplemental data. You’re most... both of which have extensive collections of publications and information on hardware, optogenetics tools...2003). Channelrhodopsin-2, a directly light-gated cation-selective membrane channel. Proceedings of the ...

  9. Build Your CRISPR Vocabulary

    Type
    Blog Post
    ... term sgRNA. Seed sequence: The 8-10 bases on the 3’ end of an RNA guide (either crRNA or sgRNA). Cas9...simplifying the CRISPR-Cas9 system for laboratory applications. At Addgene, we sometimes refer to the programmable...

  10. Antibodies 101: Introduction to Antibodies

    Type
    Blog Post
    ...Fragment Variables (scFvs). Nanobodies Figure 3: Comparison of the Hcab and nanobody. Nanobodies...molecule chaperone Skp. Front Cell Infect Microbiol 3: . https://doi.org/10.3389/fcimb.2013.00072 Additional...tool that can be used for a variety of research applications. Within the immune system, antibodies are produced...antibodies to bind proteins is useful for research applications as well because they allow scientists to target...150 kDa, a nanobody is 12-15 kDa.   Research applications for antibodies You can use antibodies for experiments...Let’s dive in and take a look at some of these applications. Western blot Western blots are used to detect... by binding to cell surface receptors. These applications are typically used for investigating signaling...

  11. CRISPR 101: Cytosine and Adenine Base Editors

    Type
    Blog Post
    ...similarly but not identically to BE3, modifying a 3-5 base window 18 bases upstream of the PAM.  David...than BE2 Nishida et al., 2016 Target-AID   Edits 3-5 base window surrounding -18 position upstream of... efficiency and product purity. Science Advances, 3(8), eaao4774. https://doi.org/10.1126/sciadv.aao4774...editors catalyze purine-to-purine or pyrimidine-to-pyrimidine base changes. Solid red arrows indicate a conversion...conversion directly catalyzed by the base editor. Dotted red arrows indicate the change introduced to ... point modifications. CRISPR base editing persists through multiple cell divisions, indicating that this...target modification in primary T cells, making them a promising tool for cell therapy applications. Dual...

  12. Viral Vectors 101: Systemic Capsids

    Type
    Blog Post
    ...while AAV-PHP.S is typically used at a dose between 3 x 1011 and 1 x 1012 vg*. Most systemic capsids are...transduction in New World monkeys   Figure 3: Evolutionary tree depicting the phylogenetic relationship...414 (2019). https://doi.org/10.1038/s41596-018-0097-3 More resources on the Addgene blog Viral Vectors 101...Sensory Ganglion Neurons Using AAV-PHP.S. eNeuro,9(3), ENEURO.0373-21.2022. https://doi.org/10.1523/ENEURO...Are Limited to C57BL/6J Mice. Molecular Therapy, 26(3), 664–668. https://doi.org/10.1016/j.ymthe.2018.01.018... 2023 * indicates viral preps available. Mechanisms of crossing the BBB are indicated in parentheses...suitability of a systemic capsid for an individual application is dependent on a number of factors, including...

  13. Validated gRNA Sequences

    Type
    Collection
    ...that are upstream of a 5' NGG 3' PAM sequence). Which CRISPR application is this gRNA sequence compatible...Resources page have been used to indicate the Cas9 application the gRNA was designed to accomplish. Validated...Plasmid ID Application Cas9 Species PubMed ID Depositor OCT4 H. sapiens CTCCCATGCATTCAAACTG 66989 cut ...Wolfe LYP1 S. cerevisiae CATAATAACGTCCAATAAAT 60847 cut S. pyogenes 25139909 Cate Mettl14 M. musculus GCCGCTCCCGGATCTCCTGC... sapiens GTTCCGCGTTACATAACTTA 50927 S. pyogenes 24346702 Wolfe Neomycin TCATGGCTGATGCAATGCGG 67594 cut...sapiens TGACATCAATTATTATACAT cut S. pyogenes 26789497 Corn CXCR4 H. sapiens CCTCTTTGTCATCACGCTTC cut S.... sativa CATATAGTTGGGTCATGGCA cut S. pyogenes 26479191 Kim DWD1 O. sativa TGCATCGTCCAAGCGCACAG cut S. pyogenes...

  14. Custom CRISPR Screens & the Green Listed Software

    Type
    Blog Post
    ... research constellations: Doench/Root (2), Zhang (3), Wu (4), Yusa (5), Wang/Lander/Sabatini (6), and ...PMID: 26780180. PubMed Central PMCID: PMC4744125. 3. Sanjana, Neville E., Ophir Shalem, and Feng Zhang...the user. This approach is useful for several applications as will be discussed below. The software could...contain multiple gRNAs targeting all genes in the indicated species and were suggested to be the best gRNAs...

  15. Viral Vectors 101: What is a Virus (and a Viral Vector)?

    Type
    Blog Post
    ...10.1007/978-3-319-07758-1_2 More resources on the Addgene blog Viral Vectors 101: Viral Applications Viral ...methods of replication. In fact, an entire classification scheme, known as the Baltimore replication classes...that in a bit! Viral genomes and replication When it comes to replication, viruses tend to march to the ...developed around how they replicate (Figure 2). Figure 2: Baltimore replication classes. Image credit: ...an intermediary DNA replication step between DNA and mRNA. DNA genome replication can involve an RNA or...cell. The cell then uses its own machinery to replicate the viral genome and proteins. This is, for the...before being translated into proteins. RNA viruses replicate their genomes using a variety of RNA or DNA intermediaries...

  16. Addgene Begins Distribution of Recombinant Antibodies

    Type
    Blog Post
    ...and Transparency of Experimental Methods. Neuron 90(3):434-6. https://doi.org/10.1016/j.neuron.2016.04.030...addgene.org if you would like to contribute to the catalog. The Catalog Will Start With Neuroscience Antibodies ...performance in various applications are included in the full webpage. Educational Resources As part of...resource, which includes recombinant antibodies, educational materials, protocols, and shared data, on our...sequence information for the antibodies in our catalog, so that you will know exactly what you are working...community about how the antibodies work in various applications, enabling you to better plan your experiments... improving research infrastructure, from our educational materials to our repository of open samples. ...

  17. Extracurricular Activities for a Strong Science Career Path

    Type
    Blog Post
    ...their required qualifications and skill sets Taking the time to identify and research 2 – 3 potential professions...Effective verbal and written communication skills are key to publication and acquisition of funding. If...  Writing Communication Publicity Consulting internships Communication Teamwork Management...Models Communication Regulatory knowledge Networking Blogging Writing Communication Networking...scientists identify potential career pathways, education and mastering new skill sets must occur by doing... skills such as leadership, management, and communication. A great approach to fully understand and acquire... science class: Science Club for Girls) Communication to diverse audiences Organization Mentorship...

  18. Summer SciComm: Science Storytelling

    Type
    Blog Post
    ...forces or (2) the result of competing desires or (3) the presence of obstacles that need to be overcome...formal scientific communications, they are fantastic fodder for science communication. The trick is to ... is far from the only way to communication science. Science communicators also use the hero’s journey,...this small glimpse into the world of science communication and can use what you've learned to share your...Finding Conflict in Science  In all science communication, what you are doing is telling a (nonfiction...details often aren’t included in scientific communications, but they’re firmly part of the story to the...conflict gives you an easy framework with which to communicate your science. The act of building towards your...

  19. 10 Ways to Share Your Science!

    Type
    Blog Post
    ...out science blogs written by practicing scientists. 3)   Consider starting up your own twitter feed or talking... Foundation Round Table. In any field, good communication skills help when it comes to finding a job. ...an argument for taking the time to hone your communication skills. So, where can a graduate student or ...opportunities than ever before for scientists to communicate about their work and their interest in science...your area or at your institution; the news or communications office is a good place to start. It’s not unusual...about science writing as a career, the Science Communication Program at the University of California, Santa... your research stories. Consider practicing communicating your research by guest blogging here, just leave...

  20. Bright Monomeric Fluorescent Proteins: mNeonGreen, mTFP1, and mWasabi

    Type
    Blog Post
    ...yellow fluorescent protein at the time. It is 1.5 to 3 times brighter than the most commonly used GFPs and...fluorescent protein: identification of the molecular determinants of color and applications in fluorescence... be used as a fusion tag for a wide range of applications from traditional imaging to FRET and stochastic...492 nm, respectively), they gave this a teal classification rather than cyan and named the protein mTFP1...the fusion protein localized to their expected locations. An analysis of mWasabi gave similar results. ...fluorescent protein: structural characterization and applications in fluorescence imaging." Biochemical Journal...
Showing: 341 - 360 of 563 results