We narrowed to 24 results for: lacZ

...yeast Gal4 activator, bacterial LexA DBD and the lacZ reporter gene (3, 4), there are now many variations...

...Adenoviral Vector ID Purpose pAdx-CMV-LacZ 73345 Expresses lacZ from the CMV promoter, forms blue colonies...-beta actin promoter with CMV enhancer. pAdx-CMV-LacZ (Addgene #73345) is uniquely suited to simplify ...

...genome; does not restrict methylated DNA fhuA2 lacZ::T7 gene1 [lon] ompT gal sulA11 R(mcr-73::miniTn10...

... TGTAAAACGACGGCCAGT In lacZ gene Forward M13 Reverse CAGGAAACAGCTATGAC In lacZ gene Reverse M13/pUC Forward...CCCAGTCACGACGTTGTAAAACG In lacZ gene Foward M13/pUC Reverse AGCGGATAACAATTTCACACAGG In lacZ gene Reverse MSCV ...GGCATACTCTGCGACATCGT 5' end of LacI Reverse LacZ-R GACAGTATCGGCCTCAGGAA 5' end of LacZ Reverse LexA CGTCAGCAGAGCTTCACCATTG...TGTAAAACGACGGCCAGT In lacZ gene Forward M13 Forward (-40) GTTTTCCCAGTCACGAC In lacZ gene Forward M13 Reverse...CAGGAAACAGCTATGAC In lacZ gene Reverse M13/pUC Forward CCCAGTCACGACGTTGTAAAACG In lacZ gene Forward M13/pUC.../pUC Reverse AGCGGATAACAATTTCACACAGG In lacZ gene Reverse MBP-F GATGAAGCCCTGAAAGACGCGCAG 3' end of maltose...

...long recombinogenic homology sequence to deliver LacZ to muscle in mice. Expression from the hybrid vector...

..., rh10, PHP.eB James M. Wilson 105531 pAAV.CMV.LacZ.bGH CMV LacZ Constitutive 5, 8 James M. Wilson 105532...Constitutive 8 James M. Wilson 105534 pAAV.TBG.PI.LacZ.bGH TBG LacZ Constitutive 8 James M. Wilson 105536...

...temperature. ID Name 13421 pAC-Kan-alphaGal4 13422 pBAC-lacZ 13424 KJBAC1 strain 21869 pKJ1267 (aka pAC-alphaGal4...

...set of vectors for C. elegans research, including lacZ and GFP fusion vectors. C. elegans optimized fluorophores...

...compatibility with the Golden Gate TALEN kit, (ii) a lacZ fragment for blue/white-screening in E.coli , (iii...

...containing easily measurable reporter genes (e.g., LacZ, luciferase, or fluorescent proteins) under the ...