Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 12 of 12 results

  1. The Pleiades Promoter Project

    Type
    Collection
    ...pEMS1492 intron-lacZ/NLS Ple22 CCKBR pEMS1493 intron-lacZ/NLS Ple23 CCKBR pEMS1494 intron-lacZ/NLS Ple24 CCKBR...pEMS1495 intron-lacZ/NLS Ple25 CCKBR pEMS1496 intron-lacZ/NLS Ple26 CCL27 pEMS1497 intron-lacZ/NLS Ple27 CCL27...pEMS1498 intron-lacZ/NLS Ple28 CCL27 pEMS1499 intron-lacZ/NLS Ple29 CCL27 pEMS1500 intron-lacZ/NLS Ple30 CD68...pEMS1504 intron-lacZ/NLS Ple34 CLDN5 pEMS1505 intron-lacZ/NLS Ple35 CLDN5 pEMS1506 intron-lacZ/NLS Ple36 CRH...pEMS1593 intron-lacZ/NLS Ple123 ICMT pEMS1594 intron-lacZ/NLS Ple124 ICMT pEMS1595 intron-lacZ/NLS Ple125 ...pEMS1597 intron-lacZ/NLS Ple129 MKI67 pEMS1600 intron-lacZ/NLS Ple131 MKI67 pEMS1602 intron-lacZ/NLS Ple135...pEMS1650 intron-lacZ/NLS Ple179 RLBP1L2 pEMS1651 intron-lacZ/NLS Ple180 RLBP1L2 pEMS1652 intron-lacZ/NLS Ple181...

  2. Zhang Lab CRISPR Page

    Type
    Collection
    ...template 60225 : control for AAV-KPL; sgRNA targeted to LacZ, plus luciferase-2A-Cre recombinase 60226 : sgRNA..., plus Cre recombinase 60228 : sgRNA targeted to LacZ, plus Cre recombinase 60229 : sgRNA cloning backbone...repair donor template. #60225 - AAV:ITR-U6-sgRNA(LacZ)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR This plasmid contains...luciferase-2A-Cre recombinase and an sgRNA targeted to LacZ, which is not present within the mouse genome. This...NeuN. As a control they designed an sgRNA targeting LacZ, which is not present in the mouse genome. These...to the mouse NeuN gene. #60228 - AAV:ITR-U6-sgRNA(LacZ)-pCBh-Cre-WPRE-hGHpA-ITR This plasmid contains two...cassettes, Cre recombinase and an sgRNA targeted to LacZ, which is not present within the mouse genome. #60229...

  3. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...Adenoviral Vector ID Purpose pAdx-CMV-LacZ 73345 Expresses lacZ from the CMV promoter, forms blue colonies...-beta actin promoter with CMV enhancer. pAdx-CMV-LacZ is uniquely suited to simplify the cloning process...

  4. Bacterial Expression Systems

    Type
    Collection
    ...Voigt When combined with pCph8 and pPLPCB(S), makes lacZ expression inducible by red light. pCph8 50552 pLtetO...responsive sensor protein that activates expression of lacZ in response to green light. BIOFAB plasmid set 1000000037...containing easily measurable reporter genes (eg. LacZ or Fluorescent Proteins ) under the control of a...Cloned by researcher Fluorescent protein, GUS, and LacZ Derivatives avaliable Philip Poole A family of promoter...protein in pACλCI-β-flap results in the activation of lacZ expression from FW102 OL2-62 . Wolfe Bacterial One-Hybrid...

  6. Worm Expression Resources

    Type
    Collection
    ...set of vectors for C. elegans research, including lacZ and GFP fusion vectors. C. elegans optimized fluorophores...

  7. TALEN Plasmids and Kits

    Type
    Collection
    ...compatibility with the Golden Gate TALEN kit, (ii) a lacZ fragment for blue/white-screening in E.coli , (iii...

  8. Control AAV Preps

    Type
    Collection
    ..., 5, 8, 9, rh10, PHP.eB Wilson 105531 pAAV.CMV.LacZ.bGH CMV LacZ Constitutive 1, 5, 8, 9 Wilson 105532...

  9. Validated gRNA Sequences

    Type
    Collection
    ...see article 60224 cut S. pyogenes 25263330 Zhang LacZ E. coli TGCGAATACGCCCACGCGAT 60225 cut S. pyogenes...AAGTTCGTATGGAAGGTTCCGTTAA 74075 interfere S. pyogenes 26829286 Lu LacZ E.coli CCCGAATCTCTATCGTGCGG 74179 cut S. pyogenes...

  10. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...pCAG-FLEX-EGFP-WPRE Hongkui Zeng AV-1-PV0102 105531-AAV1 pAAV.CMV.LacZ.bGH James M. Wilson AV-1-PV0105 105532-AAV1 pAAV.CMV.ffLuciferase.SV40...pAAV.CMV.PI.EGFP.WPRE.bGH James M. Wilson AV-5-PV0102 105531-AAV5 pAAV.CMV.LacZ.bGH James M. Wilson AV-5-PV1917 105541-AAV5 pENN.AAV.CamKII0.4...pAAV.CMV.PI.EGFP.WPRE.bGH James M. Wilson AV-8-PV0102 105531-AAV8 pAAV.CMV.LacZ.bGH James M. Wilson AV-8-PV0105 105532-AAV8 pAAV.CMV.ffLuciferase.SV40...pAAV.CMV.PI.EGFP.WPRE.bGH James M. Wilson AV-9-PV0102 105531-AAV9 pAAV.CMV.LacZ.bGH James M. Wilson AV-9-PV1845 105556-AAV9 pENN.AAV.tMCK.PI.eGFP.WPRE.bGH...EYFP Karl Deisseroth AV-2-PV0102 105531-AAV2 pAAV.CMV.LacZ.bGH James M. Wilson AV-2-PV1917 105541-AAV2 pENN.AAV.CamKII0.4...pAAV.CAG.LSL.tdTomato Hongkui Zeng AV-8-PV0142 105534-AAV8 pAAV.TBG.PI.LacZ .bGH James M. Wilson AV-1-PV1696 105539-AAV1...
Showing: 1 - 12 of 12 results