We narrowed to 12 results for: lacZ
-
TypeCollection...pEMS1492 intron-lacZ/NLS Ple22 CCKBR pEMS1493 intron-lacZ/NLS Ple23 CCKBR pEMS1494 intron-lacZ/NLS Ple24 CCKBR...pEMS1495 intron-lacZ/NLS Ple25 CCKBR pEMS1496 intron-lacZ/NLS Ple26 CCL27 pEMS1497 intron-lacZ/NLS Ple27 CCL27...pEMS1498 intron-lacZ/NLS Ple28 CCL27 pEMS1499 intron-lacZ/NLS Ple29 CCL27 pEMS1500 intron-lacZ/NLS Ple30 CD68...pEMS1504 intron-lacZ/NLS Ple34 CLDN5 pEMS1505 intron-lacZ/NLS Ple35 CLDN5 pEMS1506 intron-lacZ/NLS Ple36 CRH...pEMS1593 intron-lacZ/NLS Ple123 ICMT pEMS1594 intron-lacZ/NLS Ple124 ICMT pEMS1595 intron-lacZ/NLS Ple125 ...pEMS1597 intron-lacZ/NLS Ple129 MKI67 pEMS1600 intron-lacZ/NLS Ple131 MKI67 pEMS1602 intron-lacZ/NLS Ple135...pEMS1650 intron-lacZ/NLS Ple179 RLBP1L2 pEMS1651 intron-lacZ/NLS Ple180 RLBP1L2 pEMS1652 intron-lacZ/NLS Ple181...
-
Zhang Lab CRISPR Page
TypeCollection...template 60225 : control for AAV-KPL; sgRNA targeted to LacZ, plus luciferase-2A-Cre recombinase 60226 : sgRNA..., plus Cre recombinase 60228 : sgRNA targeted to LacZ, plus Cre recombinase 60229 : sgRNA cloning backbone...repair donor template. #60225 - AAV:ITR-U6-sgRNA(LacZ)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR This plasmid contains...luciferase-2A-Cre recombinase and an sgRNA targeted to LacZ, which is not present within the mouse genome. This...NeuN. As a control they designed an sgRNA targeting LacZ, which is not present in the mouse genome. These...to the mouse NeuN gene. #60228 - AAV:ITR-U6-sgRNA(LacZ)-pCBh-Cre-WPRE-hGHpA-ITR This plasmid contains two...cassettes, Cre recombinase and an sgRNA targeted to LacZ, which is not present within the mouse genome. #60229... -
Kazuhiro Oka Lentiviral Vectors
TypeCollection...Adenoviral Vector ID Purpose pAdx-CMV-LacZ 73345 Expresses lacZ from the CMV promoter, forms blue colonies...-beta actin promoter with CMV enhancer. pAdx-CMV-LacZ (Addgene #73345) is uniquely suited to simplify ... -
Control AAV Preps
TypeCollection..., 5, 8, 9, rh10, PHP.eB Wilson 105531 pAAV.CMV.LacZ.bGH CMV LacZ Constitutive 5, 8 Wilson 105532 pAAV....ffLuciferase Constitutive 8 Wilson 105534 pAAV.TBG.PI.LacZ.bGH TBG LacZ Constitutive 8 Wilson 105536 pAAV.TBG.PI.Null.bGH... -
Zinc Finger Consortium: OPEN Reagents
TypeCollection...temperature. ID Name 13421 pAC-Kan-alphaGal4 13422 pBAC-lacZ 13424 KJBAC1 strain 21869 pKJ1267 (aka pAC-alphaGal4... -
Worm Expression Resources
TypeCollection...set of vectors for C. elegans research, including lacZ and GFP fusion vectors. C. elegans optimized fluorophores... -
TALEN Plasmids and Kits
TypeCollection...compatibility with the Golden Gate TALEN kit, (ii) a lacZ fragment for blue/white-screening in E.coli , (iii... -
Validated gRNA Sequences
TypeCollection...see article 60224 cut S. pyogenes 25263330 Zhang LacZ E. coli TGCGAATACGCCCACGCGAT 60225 cut S. pyogenes...AAGTTCGTATGGAAGGTTCCGTTAA 74075 interfere S. pyogenes 26829286 Lu LacZ E.coli CCCGAATCTCTATCGTGCGG 74179 cut S. pyogenes... -
Bacterial Expression Systems
TypeCollection...containing easily measurable reporter genes (e.g., LacZ, luciferase, or fluorescent proteins) under the ... -
Penn Vector Core Partnership with Addgene
TypeCollection...Control Hongkui Zeng AV-1-PV0102 105531-AAV1 pAAV.CMV.LacZ.bGH Control James M. Wilson AV-1-PV0105 105532...Control James M. Wilson AV-5-PV0102 105531-AAV5 pAAV.CMV.LacZ.bGH Control James M. Wilson AV-5-PV1917 105541...Control James M. Wilson AV-8-PV0102 105531-AAV8 pAAV.CMV.LacZ.bGH Control James M. Wilson AV-8-PV0105 105532...Control James M. Wilson AV-9-PV0102 105531-AAV9 pAAV.CMV.LacZ.bGH Control James M. Wilson AV-9-PV1845 105556...EYFP Karl Deisseroth AV-2-PV0102 105531-AAV2 pAAV.CMV.LacZ.bGH James M. Wilson AV-2-PV1917 105541-AAV2 pENN.AAV.CamKII0.4...pAAV.CAG.LSL.tdTomato Hongkui Zeng AV-8-PV0142 105534-AAV8 pAAV.TBG.PI.LacZ .bGH James M. Wilson AV-1-PV1696 105539-AAV1... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection.... pyogenes NatMX Zaratiegui All_in_one_CRISPR/Cas9_LacZ 74293 Mammalian S. pyogenes Neo, mCherry Postovit... -
Neurodegeneration Plasmid Collection
TypeCollection...Flag CMV ALS Yossi Shiloh 34927 pTRE_tau-LacZ::tTA-H100Y MAPT LacZ TRE Parkinson's, FTD Mark Mayford 35000...