We narrowed to 26 results for: lacZ
-
TypeBlog Post...based on the ability to correctly assemble a lacI/lacZ cassette (designed by NEB for use in optimization...coding sequence for beta-galactosidase in the lacI/lacZ cassette. Additional confirmation of accurate assemblies...showed the expected complete sequence for the lacI/lacZ genes (1), while sequencing of white colonies showed...blue phenotype. Indeed, this was seen in all lacI/ lacZ assembly test systems; no blue colonies were obtained...from 1-, 12- and 24-fragment assemblies of the lacI/lacZ cassette, and illustrates how the volume of the ...fidelity and assembly efficiency Five fragment lacI/lacZ cassette assembly was easily achievable with high...both the 12- and 24-fragment versions of the lacI/lacZ cassette were designed and synthesized. In conjunction...
-
Plasmids 101: Screening Strategies Used in Plasmid Cloning
TypeBlog Post...the blue-white screen, which relies on the lacZ gene. lacZ encodes the enzyme š½-galactosidase which can...screening at Addgene! Some bacterial strains contain lacZ in their genome, and scientists have found that ...gene of interest is inserted into the middle of the lacZ gene, thus disrupting š½-galactosidase activity....comes in. Letās take a look at All_in_one_CRISPR/Cas9_LacZ, a CRISPR gRNA plasmid from Lynne Postovitās lab... -
Plasmids 101: Common Lab E. coli Strains
TypeBlog Post...lacIqĀ ā(lacZ)M15 zzf::Tn10Ā (TetR)Ā ā(ara-leu) 7697 araD139 fhuA ālacX74 galK16 galE15 e14-  Φ80dlacZāM15 recA1...overproduced, expression from pLac repressed more Ā LacZ β-galactosidase activity abolished Ā lacY Lactose...recA1 relA1 lac glnV44 F'[Ā ::Tn10 proAB+Ā lacIqĀ Ī(lacZ)M15] hsdR17(rK-Ā mK+)Ā XL10 Gold Tetracycline and...glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG Φ80dlacZĪM15 Ī(lacZYA-argF)U169, hsdR17(rK-Ā mK+), Ī»ā EPI300 ...Gateway cloning). F-mcrA Ī(mrr-hsdRMS-mcrBC) Φ80lacZĪM15 ĪlacX74Ā recA1Ā araĪ139 Ī(ara-leu)7697Ā galUĀ galK...Ā endA1 recA1 galE15 galK16 nupG rpsL ĪlacX74 Φ80lacZĪM15 araD139 Ī(ara,leu)7697 mcrA Ī(mrr-hsdRMS-mcrBC... large plasmids. F- mcrA Ī(mrr-hsdRMS-mcrBC) Φ80dlacZĪM15 ĪlacX74 recA1 endA1 araD139 Ī(ara, leu)7697 ... -
Plasmids 101: Blue-white Screening
TypeBlog Post...that deleting a section from the lacZ gene (a mutation called lacZĪM15) creates a non-functional β-galactosidase...well-characterized bacterial lac operon contains a gene called lacZ that encodes for the enzyme β-galactosidase. Expression...section of amino acids (called the α-peptide) to a lacZĪM15-mutant bacterial cell in transĀ complements the...use a proper E. coli strainĀ (i.e. contains the lacZĪM15 mutation): XL1-Blue, DH5α, DH10B, JM109, STBL4... -
Choosing Your Perfect Empty Backbone
TypeBlog Post...involve using a reporter vector to tag YGOI with lacZ and/or GFP (e.g.Ā pPD80_08) and following the expression... -
The Pleiades Promoter Project
TypeCollection...pEMS1492 intron-lacZ/NLS Ple22 CCKBR pEMS1493 intron-lacZ/NLS Ple23 CCKBR pEMS1494 intron-lacZ/NLS Ple24 CCKBR...pEMS1495 intron-lacZ/NLS Ple25 CCKBR pEMS1496 intron-lacZ/NLS Ple26 CCL27 pEMS1497 intron-lacZ/NLS Ple27 CCL27...pEMS1498 intron-lacZ/NLS Ple28 CCL27 pEMS1499 intron-lacZ/NLS Ple29 CCL27 pEMS1500 intron-lacZ/NLS Ple30 CD68...pEMS1504 intron-lacZ/NLS Ple34 CLDN5 pEMS1505 intron-lacZ/NLS Ple35 CLDN5 pEMS1506 intron-lacZ/NLS Ple36 CRH...pEMS1593 intron-lacZ/NLS Ple123 ICMT pEMS1594 intron-lacZ/NLS Ple124 ICMT pEMS1595 intron-lacZ/NLS Ple125 ...pEMS1597 intron-lacZ/NLS Ple129 MKI67 pEMS1600 intron-lacZ/NLS Ple131 MKI67 pEMS1602 intron-lacZ/NLS Ple135...pEMS1650 intron-lacZ/NLS Ple179 RLBP1L2 pEMS1651 intron-lacZ/NLS Ple180 RLBP1L2 pEMS1652 intron-lacZ/NLS Ple181... -
Hot Plasmids December 2018 - C. elegansĀ RNAi, TurboID, Detecting Viral Outbreaks, and Protein Binding Specificity Tools
TypeBlog Post...encodes the LacZš¼ protein. Once expressed, LacZš¼ complexes with LacZš and forms an active LacZ tetramer... -
dTAG - You're it!
TypeBlog Post...expressing a control -- for example, an FKBP12F36V-tagged LACZ) with dTAG molecules in your biological assay of... -
Bacterial Toxin-antitoxin Systems as Molecular Biology Tools
TypeBlog Post...toxin-antitoxin system, they were able to monitor lacZ activity over 48 hours in vitro without antibiotic... -
Tips for Screening with Yeast Two Hybrid Systems
TypeBlog Post...yeast Gal4 activator, bacterial LexA DBD and the lacZ reporter gene (3, 4), there are now many variations... -
Zhang Lab CRISPR Page
TypeCollection...template 60225 : control for AAV-KPL; sgRNA targeted to LacZ, plus luciferase-2A-Cre recombinase 60226 : sgRNA..., plus Cre recombinase 60228 : sgRNA targeted to LacZ, plus Cre recombinase 60229 : sgRNA cloning backbone...repair donor template. #60225 - AAV:ITR-U6-sgRNA(LacZ)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR This plasmid contains...luciferase-2A-Cre recombinase and an sgRNA targeted to LacZ, which is not present within the mouse genome. This...NeuN. As a control they designed an sgRNA targeting LacZ, which is not present in the mouse genome. These...to the mouse NeuN gene. #60228 - AAV:ITR-U6-sgRNA(LacZ)-pCBh-Cre-WPRE-hGHpA-ITR This plasmid contains two...cassettes, Cre recombinase and an sgRNA targeted to LacZ, which is not present within the mouse genome. #60229... -
Plasmids 101: E. coli Strains for Protein Expression
TypeBlog Post...genome; does not restrict methylated DNA fhuA2 lacZ::T7 gene1 [lon] ompT gal sulA11 R(mcr-73::miniTn10... -
Kazuhiro Oka Lentiviral Vectors
TypeCollection...Adenoviral Vector ID Purpose pAdx-CMV-LacZ 73345 Expresses lacZ from the CMV promoter, forms blue colonies...-beta actin promoter with CMV enhancer. pAdx-CMV-LacZ (Addgene #73345) is uniquely suited to simplify ... -
Sequencing Primers
TypeGuide...TGTAAAACGACGGCCAGT In lacZ gene M13 (-40) GTTTTCCCAGTCACGAC In lacZ gene M13 Reverse CAGGAAACAGCTATGAC In lacZ gene M13...' end of LacI, reverse primer LacZ-R GACAGTATCGGCCTCAGGAA 5' end of LacZ, reverse primer LexA CGTCAGCAGAGCTTCACCATTG...(Invitrogen) In lacZ gene M13/pUC Reverse AGCGGATAACAATTTCACACAGG (Invitrogen) In lacZ gene MBP-F GATGAAGCCCTGAAAGACGCGCAG... reverse primer M13 Reverse CAGGAAACAGCTATGAC In lacZ gene MSCV CCCTTGAACCTCCTCGTTCGACC (BD Biosciences... -
Four Ways to Package Transgenes That Exceed the Size Limit of Adeno-associated Virus
TypeBlog Post...long recombinogenic homology sequence to deliver LacZ to muscle in mice. Expression from the hybrid vector... -
Control AAV Preps
TypeCollection..., 5, 8, 9, rh10, PHP.eB Wilson 105531 pAAV.CMV.LacZ.bGH CMV LacZ Constitutive 5, 8 Wilson 105532 pAAV....ffLuciferase Constitutive 8 Wilson 105534 pAAV.TBG.PI.LacZ.bGH TBG LacZ Constitutive 8 Wilson 105536 pAAV.TBG.PI.Null.bGH... -
Zinc Finger Consortium: OPEN Reagents
TypeCollection...temperature. ID Name 13421 pAC-Kan-alphaGal4 13422 pBAC-lacZ 13424 KJBAC1 strain 21869 pKJ1267 (aka pAC-alphaGal4... -
Worm Expression Resources
TypeCollection...set of vectors for C. elegans research, including lacZ and GFP fusion vectors. C. elegans optimized fluorophores... -
TALEN Plasmids and Kits
TypeCollection...compatibility with the Golden Gate TALEN kit, (ii) a lacZ fragment for blue/white-screening in E.coli , (iii... -
Validated gRNA Sequences
TypeCollection...see article 60224 cut S. pyogenes 25263330 Zhang LacZ E. coli TGCGAATACGCCCACGCGAT 60225 cut S. pyogenes...AAGTTCGTATGGAAGGTTCCGTTAA 74075 interfere S. pyogenes 26829286 Lu LacZ E.coli CCCGAATCTCTATCGTGCGG 74179 cut S. pyogenes...