Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Showing: 31 - 60 of 61 results
  1. Dimeric CRISPR RNA-guided FokI Nuclease (RFN)

    Type
    Collection
    ...cells. Expression of this fusion is driven by a CAG promoter. Note that the FokI-dCas9 fusion encoded by ... transcript whose expression is driven by a U6 promoter. The two gRNAs expressed are flanked by Csy4 recognition...
  2. Plasmids 101: Using Transposons in the Lab

    Type
    Blog Post
    ...integration is TA dinucleotides and it leaves behind the CAG DNA footprint from its terminal sequences at the ...example, piggyBac and Tol2 are best for screening promoters and enhancers since they are biased to insert ...
  3. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ...either the Thy1 or CAG promoter, while Brainbow AAV is under control of the EF1a promoter. Livet et al....known as SpyLigase and is a protein domain that promotes the formation of an isopeptide bond between 2 ...insert fragments of DNA containing basic parts (promoters, UTRs, coding sequences, terminators, etc) into... creating a single transcriptional unit (Ex: a promoter, 5’UTR, coding region, and terminator). Next, ...individual types of pre-cloned insert modules (plant promoter, N-terminal tag, coding sequence of the gene of...target sequence in between two fragments of EGFP in pCAG-EGxxFP. The EGFP fragments contain 482bp of overlapping...
  4. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ... gRNA from a Drosophila U6:2 promoter and Cas9 from the actin 5C promoter. Addgene’s fly library web page... over 30 promoters and 140 genes, including constructs with unique tissue-specific promoters expressing...genomic libraries are cloned downstream of a minimal promoter sequence. Should one of these random stretches...activate its own transcription from the minimal promoter and its strength can be determined from its enrichment...variety of plasmids containing many different promoters, RBS’, coding sequences (CDS), and terminators...fluorophores, generate expression vectors with various promoters suitable for in vivo expression, and/or produce...mice. The Jacks Lab used this backbone to target a CAG-driven loxP-stop-loxP cassette into the Rosa26 locus...
  5. CRISPR 101: Engineering the Plant Genome Using CRISPR/Cas9

    Type
    Blog Post
    ... cauliflower mosaic virus 35S promoter (CaMV 35S) or ubiquitin promoters (Belhaj et al., 2013). Addgene...consistent between plants and other organisms, but the promoter used to drive gRNA expression is dependent upon...gRNA downstream of a plant-specific RNA pol III promoter, such as AtU6, TaU6, OsU6 or OsU3, which are commonly... gRNA” backbones which contain a plant pol III promoter and gRNA scaffold sequence and allow researchers...is commonly driven by plant-derived RNA pol II promoters which regulate expression of longer RNAs (such...expression). Examples of commonly used RNA pol II promoters for Cas9 expression include the ubiquitously expressing...Summary While different in many of the specifics - promoters used, precise protein sequences or domains, and...
  6. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...plasmid with a promoter that will be functional in your host organism. Host Relevant Promoters Representative...vector (PGK1 promoter, 2μ) pXP316 - Yeast expression vector (TEF1 promoter, CEN/ARS) pAG304GAL-ccdB...vector (PGK1 promoter, CEN/ARS) pXP222 - Yeast expression vector (PGK1 promoter, 2μ) pAG305GAL-ccdB...Representative Empty Backbones Promoter Measure promoter strength pBV-Luc - Luciferase ...Representative Empty Backbones Mammalian CMV, SV40, EF1a, CAG pSG5L Flag HA - Transient expression... vectors with various markers, promoters, etc pRS420 - Yeast expression ... expression under the metallothionein promoter pACU2 - Modified pUAST vector containing...
  7. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...fluorescent proteins, 8 constitutive promoters, 2 includible promoters, 3 polyA terminators and various pieces...sequences. Several pre-constructed promoter-selection marker or promoter-inducible expression related vectors...all chemically inducible promoters; 3) improving the strength of the promoters used; and 4) optimizing ...ideal promoter/location combination. However, other constructs which contain different promoters and/or...to study the human GM-CSF promoter and enhancer, a finely regulated promoter controlled by a mixture of...multiple copies of a transcription factor to a promoter and localization of a protein via the presence...are inserted between the truncated gene and the promoter to prevent leaky expression of this resistance...
  8. Lentiviral Prep Service

    Type
    Collection
    ...Expression of SARS-CoV-2 orf3a protein Krogan 141347 pBOB-CAG-SARS-CoV2-Spike-HA Expression of SARS-CoV-2 spike...Cas9 protein and blasticidin resistance from EFS promoter. Lentiviral backbone. Zhang Cas9 and Accessories...3rd gen lentiviral eGFP expression vector, CMV promoter, Hygro Campeau Return to top Don’t See What You...
  9. Binning Singletons: Tackling Conference Networking When You Don’t Know Anyone

    Type
    Blog Post
    ... of the people who participated as mentors or promoters were connected to that Tweet Up in 2013. These...connections brought in folks I didn’t yet know and promotion from those who could not participate but provided...BinningSingletons mixer with new friends @iprophage @robincagle5 pic.twitter.com/52KQDMeSjO — Brianna Weiss (@... even more valuable program to Microbe 2020 in Chicago.  Finding our place in networking and mentoring...
  10. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... Other Promoter CMV T7 polH GAL Other Clear Filters Addgene ID Plasmid Name Gene Tags Promoter Disease...Friedreich ataxia Michael Ristow 14994 pDRIVE-CAG-hFX-HA FXN HA, AU1 CAG Friedreich ataxia Michael Ristow 15239...wtTDP43tdTOMATOHA TARDBP HA, tdTomato CAG ALS Zuoshang Xu 28206 TDP43 NOTAG1 TARDBP CAG ALS Zuoshang Xu 28207 TDP43...TDP43 NOTAG2 TARDBP CAG ALS Zuoshang Xu 28208 TDP43 NOTAG3 TARDBP CAG ALS Zuoshang Xu 28209 TDP43 NOTAG6...NOTAG6 TARDBP CAG ALS Zuoshang Xu 28210 TDP43 NOTAG11 TARDBP CAG ALS Zuoshang Xu 29340 pcDNA3.1/GS-DJ1-R98Q-V5...30137 pCAX APP 695 APP CAG Alzheimer's Dennis Selkoe 30138 pCAX APP 751 APP CAG Alzheimer's Dennis Selkoe...pCAX APP delta CT APP CAG Alzheimer's Dennis Selkoe 30144 pCAX APP AENATA APP CAG Alzheimer's Dennis Selkoe...
  11. Hot Plasmids and Viral Preps - May 2021

    Type
    Blog Post
    ...to measure time. These plasmids with different promoters driving expression of Cas9 were used in this study...ready-to-use AAV vectors expressing GCaMP6f with this promoter. Image calcium transients in PV interneurons with....org/10.1074/jbc.RA120.01289     Novel protein cage provides simple enzyme protection in yeast bioproduction...
  12. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...Chien lab (Kwan et al., 2007) and includes four promoters, six fluorophores with nonoverlapping emission...neurodegenerative diseases, the Cole Lab selected promoters for cell types directly linked to disease, including... components can be controlled by a variety of promoters for versatile and robust engineering. These components...enzymatic activity. In addition, proteins can be “caged” by fusion to specific domains thereby rendering... The authors use PhoCl in combination with this caging technique to beautifully demonstrate light-dependent...
  13. Identifying Sequence Elements with SnapGene's Feature Database

    Type
    Blog Post
    ...straightforward to define, but for control elements such as promoters and transcription terminators, the boundaries ...Genetics and Cell Biology at the University of Chicago. He was an early depositor at Addgene, and conceived...
  14. Validated gRNA Sequences

    Type
    Collection
    ... H. sapiens GCAGGTAGCAAAGTGACGCCGA 46917 interfere S. pyogenes 23849981 Qi CYC1m promoter S. cerevisiae...cerevisiae ACAGAGCACATGCATGCCAT 64385 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ACTAATACTTTCAACATTTT.... pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ATATCGAATTCCTGCAGCCC 64382 activate S. pyogenes 23977949...S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae TACATACAGTAGGATCCTA 64381 activate S. pyogenes 23977949...S. cerevisiae TGTATGTACATACAGTACCC 64386 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae...scaffold S. pyogenes 25533786 Qi & Lim TET promoter TATCAGTGATAGAGAAAAGT 46923 interfere S. pyogenes 23849981... or repression experiments use targets within promoters. When possible, the categories described on Addgene's...
  15. Church Lab CRISPR Plasmids

    Type
    Collection
    ... inducible promoters as well as a gRNA expression construct using the SNR52 snoRNA promoter. A protocol...gRNAs) expressed from the human U6 polymerase III promoter. Cas9 unwinds the DNA duplex and cleaves both ...in S. cerevisiae (budding yeast) from the TEF1 promoter 43804 p415-GalL-Cas9-CYC1t A human codon-optimized...in S. cerevisiae (budding yeast) from the GalL promoter 43803 p426-SNR52p-gRNA.CAN1.Y-SUP4t A gRNA expression...in S. cerevisiae (budding yeast) from the SNR52 promoter Orthogonal CRISPR/Cas9 Systems: Table 3 We have...Mammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTG 48675 M-ST1n-VP64 Mammalian ST1-VP64 nuclease-null...Mammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTG 48674 M-SPn-VP64 Mammalian SP-VP64 nuclease-null...
  16. Promoters

    Type
    Guide
    ...Reference Molecular Biology Reference Promoters Promoters Definition A promoter is a region of DNA where transcription...silencers. Promoter Regions There are three main portions that make up a promoter: core promoter, proximal...Proximal Promoter Further upstream from the core promoter you will find the proximal promoter which contains...bind. Distal Promoter The final portion of the promoter region is called the distal promoter which is upstream...1 alpha CAG Constitutive Strong hybrid mammalian promoter PGK Constitutive Mammalian promoter from phospholycerate...Specific Drosophila promoter containing Gal4 binding sites Bacterial Promoters Promoters in bacteria contain...tryptophan Promoter from E. coli tryptophan operon Ptac Regulated like the lac promoter Hybrid promoter of lac...
  17. How to Design Your gRNA for CRISPR Genome Editing

    Type
    Blog Post
    ...nuclease-dead Cas9 (dCas9) is directed near the promoter of a target gene. Here, the target window is not... shown that the FANTOM database, which relies on CAGE-seq to directly capture the mRNA cap, provides the...
  18. Jaenisch Lab CRISPR Plasmids

    Type
    Collection
    ...provides the specificity and is designed to target promoters or enhancers of genes of interest. Different flavors...expressing both dCas9VP48 and sgRNA from separate promoters. 48238 pAC152-dual-dCas9VP64-sgExpression : Dual...expressing both dCas9VP64 and sgRNA from separate promoters. 48239 pAC153-dual-dCas9VP96-sgExpression : Dual...expressing both dCas9VP64 and sgRNA from separate promoters. 48240 pAC154-dual-dCas9VP160-sgExpression : Dual...expressing both dCas9VP64 and sgRNA from separate promoters. Table 2. pmax dCas9 Activator Expression Plasmids...Destination vector derived from Clontech's pmax (CAGGS) expression vector....
  19. Lentivirus Plasmids

    Type
    Collection
    ...shRNA under the control of a tet-responsive H1 promoter Trono 11651 pLVUT-tTR-KRAB 3rd Inducible expression...11795 pLL3.7 3rd Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor...silencing were added; Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor...with a chimeric 5’LTR, Any expression cassette (promoter and gene of interest) can be cloned into the plasmid...coexpression. Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP...35617 pCAG-Eco N/A Envelope Ecotropic MLV expressing envelope plasmid Nienhuis and Salmon 35616 pCAG-VSVG...
  20. Synthetic Biology - Assembly Standards Guide

    Type
    Collection
    .... Therefore, the same reaction which ligates a promoter into an empty backbone can be repeated to ligate...ligate your gene of interest after the promoter, and so on. The following table provides information for... EcoR1 , NotI , XbaI Suffix: T ACTAGT A GCGGCCG CTGCAG Suffix Enzymes: SpeI , NotI , PstI Scar: TACTAGAG...Enzymes: EcoR1 , NotI , Spel Suffix: GCTAGC GCGGCCG CTGCAG Suffix Enzymes: Nhel , NotI , PstI Scar: GCTAGT... EcoR1 , NotI , XbaI Suffix: T ACTAGT A GCGGCCG CTGCAG Suffix Enzymes: SpeI , NotI , PstI Scar: ACTAGA..., (NgoMIV) Suffix: ACCGGT TAAT ACTAGT A GCGGCCG CTGCAG Suffix Enzymes: Agel , Spel , Notl, Pstl Scar: ...
  21. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...sgRNA with U6 promoter 48962 Worm HindIII none S. pyogenes de Bono sgRNA with rpr-1 promoter 48961 Worm ...of two sgRNAs from independent U6 promoters and Cas9 from CBh promoter. Ventura A CRISPR/Cas9 toolkit for...along with 1-4 sgRNAs expressed from independent promoters. sgRNAs are cloned into separate vectors and then... assembly of single gRNA vectors with various promoters, plasmids for assembling multiple gRNAs into one...pGGDestTol2LC vector. Uses five distinct zebrafish U6 promoters for sgRNA expression. Chen pCFD4-U6:1_U6:3tandemgRNAs...expression of two gRNAs from Drosophila U6:1 and U6:3 promoters. Bullock pCFD5 Drosophila Utilizes endogenous ...Mb Cpf1 Kim pCAG-SpCas9-GFP-U6-gRNA 79144 Mammalian hU6 yes, cut S. pyogenes EGFP Zou pCAG-eCas9-GFP-U6...
  22. Chemogenetics Guide

    Type
    Guide
    ...Chemogenetic Plasmids ! Table 3. Promoters used in chemogenetics plasmids Promoter Cell Specificity hSyn1, CaMKIIa...controlled with cell-type specific promoters. Table 3 lists some common promoters found in chemogenetic receptor... GFAP Glia CD68 Microglia Dlx Interneurons EF1a, CAG General expression Localization. Depending on the...
  23. Molecular Biology Reference

    Type
    Guide
    ...human cells, the promoter will be a human or mammalian promoter sequence. The promoter can also direct ...tissue-specific promoter (e.g., a liver-specific promoter). The strength of the promoter is also important...particular plasmid. Promoter Region Drives transcription of the insert. The promoter is designed to recruit...expression (i.e., a strong promoter directs high expression, whereas weaker promoters can direct low/endogenous...information about promoters, both bacterial and eukaryotic, as well as common promoters used in research...contain a promoter sequence, a transcription terminator sequence, and the inserted gene. The promoter region... of Replication Plasmids 101: The Promoter Region-Let’s Go Promoters Reference Page Plasmids 101: How ...
  24. Sequencing Primers

    Type
    Guide
    ...vectors with AOX1 promoter, forward primer 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter, forward primer...Human U6 promoter, forward primer LNCX AGCTCGTTTAGTGAACCGTCAGATC (BD Biosciences) Human CMV promoter, forward...metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter, forward primer...Nopaline synthase promoter, forward primer Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter, forward primer... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward...ATTTAGGTGACACTATAG SP6 promoter, forward primer T3 GCAATTAACCCTCACTAAAGG T3 promoter, forward primer T7 TAATACGACTCACTATAGGG...baculovirus vector with polyhedrin promoter, reverse primer pQE promoter CCCGAAAAGTGCCACCTG (Qiagen) 5' of...
  25. Immunology Research Plasmids and Resources

    Type
    Collection
    ... MCH2, MCH2R, SLT MDK midkine (neurite growth-promoting factor 2) FLJ27379, MK, NEGF2 MET met proto-oncogene... different fluorescent proteins, 10 mammalian promoters and enhancers, 3 polyA signals as well as selection...receptor 3 - GAST gastrin GAS GCG glucagon GLP1, GLP2, GRPP GCGR glucagon receptor GGR, MGC138246 GDF1 growth...MGC70354, foveolin GLP1R glucagon-like peptide 1 receptor MGC138331 GLP2R glucagon-like peptide 2 receptor...
Showing: 31 - 60 of 61 results