We narrowed to 59 results for: cag promoter

...Viviana Gradinaru 104102 pCAG-tTA Mammalian expression of tTA from the CAG promoter for Tet-Off tTA-Advanced...upstream of a minimal CMV promoter, and other tet- or dox-dependent promoters (sometimes generally called... CMV promoter. In the absence of tetracycline, tTA binds to the TRE and its VP16 domain promotes gene ...transactivators and promoters are generally cross-compatible. Your choice of transactivator, promoter, and type ...from EF1α promoter, for Tet-Off. See Plasmid #27106 for rtTA. tTA Edward Hsiao 99118 pAAV-CAG-tTA AAV Tet-Off... Tet-Off vector, expresses tTA from the CAG promoter. See article ( Chan et al., 2017 ) for other viral...Additional Resources Blog: Inducible Promoters Blog: Repressible Promoters Mammalian shRNA Plasmids Cre-lox...

...integration is TA dinucleotides and it leaves behind the CAG DNA footprint from its terminal sequences at the ...example, piggyBac and Tol2 are best for screening promoters and enhancers since they are biased to insert ...

...DREADD KOR DREADD PSAM4 GlyR Promoter Synapsin CaMKIIa CD68 Dlx GFAP nEF CAG E2 regulatory element Tag Fusion...none 1, 9, PHPeB Jordane Dimidschstein 52536 rAAV-CAG::FLEX-rev:: hM4D-2a-GFP hM4D(Gi) - Inhibition GFP...GFP Cre-dependent 1 Scott Sternson 228902 pAAV-CAG-DIO-HA-HCARD-P2A-mCitrine HCAD(Gi) - Inhibition mCitrine...

...either the Thy1 or CAG promoter, while Brainbow AAV is under control of the EF1a promoter. Livet et al....known as SpyLigase and is a protein domain that promotes the formation of an isopeptide bond between 2 ...insert fragments of DNA containing basic parts (promoters, UTRs, coding sequences, terminators, etc) into... creating a single transcriptional unit (Ex: a promoter, 5’UTR, coding region, and terminator). Next, ...individual types of pre-cloned insert modules (plant promoter, N-terminal tag, coding sequence of the gene of...target sequence in between two fragments of EGFP in pCAG-EGxxFP. The EGFP fragments contain 482bp of overlapping...

... gRNA from a Drosophila U6:2 promoter and Cas9 from the actin 5C promoter. Addgene’s fly library web page... over 30 promoters and 140 genes, including constructs with unique tissue-specific promoters expressing...genomic libraries are cloned downstream of a minimal promoter sequence. Should one of these random stretches...activate its own transcription from the minimal promoter and its strength can be determined from its enrichment...variety of plasmids containing many different promoters, RBS’, coding sequences (CDS), and terminators...fluorophores, generate expression vectors with various promoters suitable for in vivo expression, and/or produce...mice. The Jacks Lab used this backbone to target a CAG-driven loxP-stop-loxP cassette into the Rosa26 locus...

... the barcode proteins under the constitutive CAG promoter (Addgene #242764–242781), but E11 Bio has also...

... cauliflower mosaic virus 35S promoter (CaMV 35S) or ubiquitin promoters (Belhaj et al., 2013). Addgene...consistent between plants and other organisms, but the promoter used to drive gRNA expression is dependent upon...gRNA downstream of a plant-specific RNA pol III promoter, such as AtU6, TaU6, OsU6 or OsU3, which are commonly... gRNA” backbones which contain a plant pol III promoter and gRNA scaffold sequence and allow researchers...is commonly driven by plant-derived RNA pol II promoters which regulate expression of longer RNAs (such...expression). Examples of commonly used RNA pol II promoters for Cas9 expression include the ubiquitously expressing...Summary While different in many of the specifics - promoters used, precise protein sequences or domains, and...

...fluorescent proteins, 8 constitutive promoters, 2 includible promoters, 3 polyA terminators and various pieces...sequences. Several pre-constructed promoter-selection marker or promoter-inducible expression related vectors...all chemically inducible promoters; 3) improving the strength of the promoters used; and 4) optimizing ...ideal promoter/location combination. However, other constructs which contain different promoters and/or...to study the human GM-CSF promoter and enhancer, a finely regulated promoter controlled by a mixture of...multiple copies of a transcription factor to a promoter and localization of a protein via the presence...are inserted between the truncated gene and the promoter to prevent leaky expression of this resistance...

...plasmid with a promoter that will be functional in your host organism. Host Relevant Promoters Representative...interest to create a luciferase reporter Promoter Measure promoter strength pBV-Luc - Luciferase ...sgRNA/PTG with rice snoRNA U3 promoter and Cas9 with rice ubiquitin promoter for Agrobacterium-mediated ...proteins, a multiple cloning site (MCS), an inducible promoter, and/or a selectable marker. They are frequently...Representative Empty Backbones Mammalian CMV, SV40, EF1a, CAG, Ubc Transient expression - Gradia Lab plasmids for...T-DNA entry plasmid (attR1 & attR2); Zea mays Ubi1 promoter and Hygromiycin resistance marker Also see more... expression under the metallothionein promoter pFastBac LIC and pFastBac Dual LIC - Vectors from...

...James Trimmer 227686 pPB-CAG-shLRRK2-mCherry-CAAX LRRK2 mCherry CAG Parkinson's Cagla Eroglu 231998 pSPcas9...Yeast Other Promoter CMV T7 polH GAL Other Clear Filters ID Plasmid Name Gene Tags Promoter Disease PI ...Friedreich ataxia Michael Ristow 14994 pDRIVE-CAG-hFX-HA FXN HA, AU1 CAG Friedreich ataxia Michael Ristow 15239...wtTDP43tdTOMATOHA TARDBP HA, tdTomato CAG ALS Zuoshang Xu 28206 TDP43 NOTAG1 TARDBP CAG ALS Zuoshang Xu 28207 TDP43...TDP43 NOTAG2 TARDBP CAG ALS Zuoshang Xu 28208 TDP43 NOTAG3 TARDBP CAG ALS Zuoshang Xu 28209 TDP43 NOTAG6...NOTAG6 TARDBP CAG ALS Zuoshang Xu 28210 TDP43 NOTAG11 TARDBP CAG ALS Zuoshang Xu 29340 pcDNA3.1/GS-DJ1-R98Q-V5...30137 pCAX APP 695 APP CAG Alzheimer's Dennis Selkoe 30138 pCAX APP 751 APP CAG Alzheimer's Dennis Selkoe...

... of the people who participated as mentors or promoters were connected to that Tweet Up in 2013. These...connections brought in folks I didn’t yet know and promotion from those who could not participate but provided...BinningSingletons mixer with new friends @iprophage @robincagle5 pic.twitter.com/52KQDMeSjO — Brianna Weiss (@... even more valuable program to Microbe 2020 in Chicago.  Finding our place in networking and mentoring...

...to measure time. These plasmids with different promoters driving expression of Cas9 were used in this study...ready-to-use AAV vectors expressing GCaMP6f with this promoter. Image calcium transients in PV interneurons with....org/10.1074/jbc.RA120.01289     Novel protein cage provides simple enzyme protection in yeast bioproduction...

...Chien lab (Kwan et al., 2007) and includes four promoters, six fluorophores with nonoverlapping emission...neurodegenerative diseases, the Cole Lab selected promoters for cell types directly linked to disease, including... components can be controlled by a variety of promoters for versatile and robust engineering. These components...enzymatic activity. In addition, proteins can be “caged” by fusion to specific domains thereby rendering... The authors use PhoCl in combination with this caging technique to beautifully demonstrate light-dependent...

...several weeks which may also depend on transgene or promoter choice. Behaviors you can study using viral vectors...if an experimenter picks up a mouse from the home cage and places it into the experimental setup, the mouse...individually versus in groups), health status, diet, cage enrichment, stress level, origin (vendor or in-house...

...straightforward to define, but for control elements such as promoters and transcription terminators, the boundaries ...Genetics and Cell Biology at the University of Chicago. He was an early depositor at Addgene, and conceived...

... a hole in their cage. Since dopamine is an important neurotransmitter that promotes reward-motivated ...

...localization sequence) and expressing it from a CAGGs promoter. However FLPe is still less efficient than ...binding domain (LDB) to the C-terminus of FLP or Cre (pCAG-CreERT2 #14797). These Cre/ FLP versions are retained...

...discussions. Get your voice out there. Use Twitter to promote your other science communication activities, e....You can draw live sketches at conferences like @ATJCagan or create agar art with colorful microbes? Try...

...Reference Promoters Promoters Prokaryotic Promoters Eukaryotic Promoters Resources A promoter is a region...a eukaryotic promoter: the core promoter, the proximal promoter, and the distal promoter (Figure 4). Figure...Eukaryotic Promoters Eukaryotic promoters are much more complex and diverse than prokaryotic promoters and span...bind. Distal Promoter The final portion of the promoter region is called the distal promoter, which is upstream...Insect Strong promoter from baculovirus CAG Constitutive Mammalian Strong hybrid promoter; contains CMV...elements, insulators, and silencers. Bacterial Promoters Promoters in bacteria contain two short DNA sequences... binding to the promoter region. Each sigma factor recognizes different core promoter sequences. Figure...

...nuclease-dead Cas9 (dCas9) is directed near the promoter of a target gene. Here, the target window is not... shown that the FANTOM database, which relies on CAGE-seq to directly capture the mRNA cap, provides the...

...shRNA under the control of a tet-responsive H1 promoter. Didier Trono 11651 pLVUT-tTR-KRAB 3rd Inducible...11795 pLL3.7 3rd Expresses shRNA under mouse U6 promoter. CMV-EGFP reporter cassette is included to monitor...epigenetic silencing. Expresses shRNA under mouse U6 promoter. CMV-EGFP reporter cassette is included to monitor...with a chimeric 5’LTR. Any expression cassette (promoter and gene of interest) can be cloned into the plasmid.... Didier Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP... GFP Puro (658-5) 3rd eGFP expression with CMV promoter and puromycin selection. See Campeau et al. (2009...packaging construct encoding tat . Jakob Reiser 35617 pCAG-Eco Ecotropic MLV expressing envelope plasmid. Arthur...

...iPSC-derived osteoblasts and osteoclasts together promote bone regeneration in 3D biomaterials. Sci Rep, ... damage results in the transdifferentiation of glucagon-producing α-cells into insulin-producing β-like-cells...

...commercially available. Table 4: Common promoters in chemogenetics plasmids Promoter Cell Specificity hSyn1, CaMKIIa...controlled with cell-type specific promoters. Table 4 lists some common promoters found in chemogenetic receptor... GFAP Glia CD68 Microglia Dlx Interneurons EF1a, CAG General expression Targeted Expression Depending ...

...numerous high-frequency off-target sites in the HBG promoter that were missed by standard workflows, highlighting...off-targets remains challenging. Siyuan Zou (U. Chicago) presented Inrich-seq, a method that captures the...

.... Therefore, the same reaction which ligates a promoter into an empty backbone can be repeated to ligate...ligate your gene of interest after the promoter, and so on. The following table provides information for... EcoR1 , NotI , XbaI Suffix: T ACTAGT A GCGGCCG CTGCAG Suffix Enzymes: SpeI , NotI , PstI Scar: TACTAGAG...Enzymes: EcoR1 , NotI , Spel Suffix: GCTAGC GCGGCCG CTGCAG Suffix Enzymes: Nhel , NotI , PstI Scar: GCTAGT... EcoR1 , NotI , XbaI Suffix: T ACTAGT A GCGGCCG CTGCAG Suffix Enzymes: SpeI , NotI , PstI Scar: ACTAGA..., (NgoMIV) Suffix: ACCGGT TAAT ACTAGT A GCGGCCG CTGCAG Suffix Enzymes: Agel , Spel , Notl, Pstl Scar: ...

...downstream from a promoter to drive expression of the inserted gene. Insert The gene, promoter, or other DNA...particular plasmid. Promoter Region Drives transcription of the insert. The promoter recruits transcriptional...strength of the promoter can control the level of insert expression, as a strong promoter directs high expression...weaker promoters can direct low/endogenous expression levels. For more information about promoters, check...resources, including: Molecular Cloning Techniques Promoters Sequencing Primers Origins of Molecular Genetics... for a variety of studies used to investigate promoters, small RNAs, and other genetic elements. Plasmid...check out our promoters reference page . Selectable Marker Used to select for cells that have successfully...

...for, such as the promoter or cloning method of choice. ID Plasmid Description Promoter Cloning Method PI...Addgene’s collection includes plasmids containing promoters that drive general and species-specific gene expression...constitutive and arbuscular mycorrhiza-inducible promoters to label organelles, membranes and cytoskeletal... (Link opens in a new window) — The initiative promotes interdisciplinary exchange, open technologies,...CRISPR. Successfully validated in tomato, tobacco, Medicago truncatula , wheat, and barley. Return to top ...

...vectors with AOX1 promoter Forward 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter Forward AC5 ACACAAAGCCGCTCCATCAG...araBAD promoter Forward pBAD Reverse GATTTAATCTGTATCAGG For vectors with E. coli araBAD promoter Reverse... shock promoter Forward EF-1α Forward TCAAGCCTCAGACAGTGGTTC Human elongation factor-1α promoter Forward...GACTATCATATGCTTACCGT Human U6 promoter Forward LNCX AGCTCGTTTAGTGAACCGTCAGATC Human CMV promoter Forward Luc-F AGTCAAGTAACAACCGCGA...Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter Forward Myc GCATCAATGCAGAAGCTGATCTCA...Nopaline synthase promoter Forward Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter Forward OpIE2 Forward...

... MCH2, MCH2R, SLT MDK midkine (neurite growth-promoting factor 2) FLJ27379, MK, NEGF2 MET met proto-oncogene... different fluorescent proteins, 10 mammalian promoters and enhancers, 3 polyA signals as well as selection...receptor 3 - GAST gastrin GAS GCG glucagon GLP1, GLP2, GRPP GCGR glucagon receptor GGR, MGC138246 GDF1 growth...MGC70354, foveolin GLP1R glucagon-like peptide 1 receptor MGC138331 GLP2R glucagon-like peptide 2 receptor...