We narrowed to 57 results for: eomes
-
TypeCollection... As Cpf1 Qi 91715 pKEE401 yes, cut S. pyogenes Neomycin Chen Do you have suggestions for other plasmids...
-
CRISPR References and Information
TypeCollection...cloning gRNA cloning vector Retroviral vectors: neomycin (pSIR-neo) , GFP (pSIR-GFP) , DsRed (pSIR-DsRed-Express2... -
Luciferase Plasmid Collection
TypeCollection...destabilized mutants which serve as sensors of proteome stress. pHLuc : An extracellular pH sensor consisting... -
Tetracycline Inducible Expression
TypeCollection...with puromycin selection. See Plasmid #21916 for neomycin selection. TetR H1-2O2 Dmitri Wiederschain 85966... -
Sequencing Primers
TypeGuide...CGTTGGCTACCCGTGATATT 3' end of neomycin resistance gene Forward Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance ... -
Antibody Guide
TypeGuide...done using methods such as transcriptomics or proteomics. This approach is often appropriate for quantitative...validation This method uses peptide identification by proteomics (Capture MS) to validate the identity of proteins... -
Optogenetics Guide
TypeGuide...Red-shifted chloride-conducting channel from Proteomonas sulcata 540 Phobos Blue-shifted iC++ variant ...