Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 4 of 4 results

  1. Sequencing Primers

    Type
    Guide
    ... end of neomycin resistance gene, forward primer Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance...

  2. Antibody Guide

    Type
    Guide
    ...done using methods such as transcriptomics or proteomics. This approach is often appropriate for quantitative...validation This method uses peptide identification by proteomics (Capture MS) to validate the identity of proteins...

  3. Retrovirus Guide

    Type
    Guide
    ...MCS for cloning X gene, an S V40 promoter, and N eomycin selection. Return to Top Glossary Plasmid Type ...

  4. Optogenetics Guide

    Type
    Guide
    ...Red-shifted chloride-conducting channel from Proteomonas sulcata 540 Phobos Blue-shifted iC++ variant ...
Showing: 1 - 4 of 4 results