...positions for testing phosphoproteomics methods, proteomics search algorithms, proteomics phosphosite localization...multi-purpose, regenerable, proteome-scale, human phosphoserine resource for phosphoproteomics. Gassaway BM, Li ...rEcoli XPS, pSerOTS-C1*). The synthetic human phosphoproteome. The Rinehart lab synthesized 110,139 unique...anticipated to be useful for laboratories performing phosphoproteomic experiments in need of reference spectra or... 2022) is adapted from the synthetic human phosphoproteome. The iSPI resource subdivides the 110,139 human...Encoding human serine phosphopeptides in bacteria for proteome-wide identification of phosphorylation-dependent...644. PubMed Kinase Substrate Profiling Using a Proteome-wide Serine-Oriented Human Peptide Library. Barber...

...Maize Transcription Factor ORFeome - John Gray. Rice Transcription Factor ORFeome - John Gray. Plant transcription...

...done using methods such as transcriptomics or proteomics. This approach is often appropriate for quantitative...validation This method uses peptide identification by proteomics (Capture MS) to validate the identity of proteins...

...expression profiling. Martin S et al., Mol Cell Proteomics. 2010 Dec;9(12):2654-65. PubMed 20802085 Jamb...

...core of the deorphanizing engine. Genetic and proteomic interactions represent the framework that provides...

...reporter vector expressing firefly luciferase with neomycin resistance. Other Resources Protocols Bloom lab...

...Teichmann S and Wright GJ Molecular & cellular proteomics 2010 Dec; 9(12):2654-65. A cell surface interaction...

...Receptor 1 (PEAR1) Ligand. Sun Y et al., Mol Cell Proteomics. 2015 May; 14(5):1265-74. PubMed 25713122 Plasmid...

...1 none As Cpf1 Qi pKEE401 yes, cut S. pyogenes Neomycin Chen Do you have suggestions for other plasmids...

...repeat. A retroviral expression vector with the neomycin resistance gene 64325 3xFLAG-dCas9/p-bacteria ...

...Tet-pLKO-neo 3rd inducible expression of shRNA; neomycin selection. See plasmid 21915 for Puro resistance...

...Organism Representative Empty Backbones Neomycin (G418) Mammalian pBABE-neo - Retroviral ...

...lentiviral plasmid for inducible expression of shRNA; neomycin selection; plasmid 21915 has puromycin selection...

...cloning gRNA cloning vector Retroviral vectors: neomycin (pSIR-neo) , GFP (pSIR-GFP) , DsRed (pSIR-DsRed-Express2...

...TCAGGCAGTGCAGGCCACcatgatactggccaccATCTTGTGCTGTGTGGGA eomesb TAL3430 & TAL3431 TCTTCTCACCCGGAGGCGgaggaggagaaagtttcTCCGGTAGTTTGTGGTGA...

...multicistronic expression of GFP and/or mCherry, with neomycin cassette Zebrafish, Sea urchin, Xenopus, and C...

...GTTCCGCGTTACATAACTTA 50927 S. pyogenes 24346702 Wolfe Neomycin TCATGGCTGATGCAATGCGG 67594 cut S. pyogenes 26178787...