We narrowed to 33 results for: αGFP
-
TypeBlog Post...selectable marker and a desired genetic payload (ex: GFP). Thus, cells can be both sorted using FACS and isolated...allows translation of the reporter gene resulting in GFP signal. With the addition of standards, the assay... plasmids could also be transformed into Alphaproteobacteira, Betaproteobacteria, and Gammaproteobacteria...
-
Sequencing Primers
TypeGuide...domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP, forward primer GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...promoter, forward primer Alpha-factor TACTATTGCCAGCATTGCTGC (Invitrogen) Alpha factor signal sequence, ...terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward primer hUBCpro-F...CCATCTAATTCAACAAGAATTGGGACAAC (Ahmad lab) 5' end of GFP, reverse primer GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae...reverse primer XEF1a TTTCGCCCTAACTTCGTGAT Xenopus EF1 alpha enhancer/promoter, forward primer Xpress Forward...forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG (BD Biosciences) 3' end of EGFP, forward primer EGFP-N CGTCGCCGTCCAGCTCGACCAG...end of EGFP, reverse primer EXFP-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP... -
Neurodegeneration Research Collection
TypeCollection... and Noteworthy: Use a CRISPRi system to target alpha-synuclein. Sastre et al. Sci Rep. 2023 Oct 18. ...Cre-dependent expression of diphtheria toxin receptor (DTR)–GFP fusion protein. Azim et al. Nature. 2014 Apr 17. ... -
Scientists Map the SARS-CoV-2-Human Interaction Network
TypeBlog Post...the viral protease, Nsp5. Our set also includes a GFP construct as a control. For easier portability, all...selection. Expression is driven by a fairly strong EF1alpha promoter. We have verified expression of correctly-sized... -
Kazuhiro Oka Lentiviral Vectors
TypeCollection...shRNA against mouse TNF-alpha mRNA from the mouse U6 promoter pCDH-EF1-Nluc-P2A-copGFP-T2A-Puro 73022 Expresses... pCDH-EF1-copGFP 73030 Expresses copGFP from the EF1 promoter pCDH-EF1s-Nluc-P2A-copGFP-T2A-Puro 73032...pCDH-EF1s-copGFP 73034 Expressed copGFP from a truncated EF1 promoter pCDH-CMV-Nluc-P2A-copGFp-T2A-Puro...Lentiviral Vector ID Purpose pCDH-EF1-DIO-copGFP 72253 Expresses copGFP under EF-1 promoter when Cre is expressed... N-acethyl-transferase) pCDH-CB-copGFP-T2A-iCre 72256 Expresses copGFP and iCre under from the CB promoter...CB promoter pCDH-CB-FLPe-P2A-copGFP-T2A-Puro 72258 Expresses FLPe, copGFP and the puromycin resistance...tdTomato from the CB promoter pCDH-EF1-Fon-copGFP 72260 Expresses copGFP from the EF1 promoter when FLP is expressed... -
Protein Tagging with CRISPR/Cas9: A Conversation with Mendenhall and Myers
TypeBlog Post...selection cassette. They could also switch from FLAG to GFP or a different epitope. Addgene: Do you have any ... the genome. Mendenhall and Richard Myers of HudsonAlpha (where Mendenhall is also an adjunct faculty ... -
Plasmids 101: Repressible Promoters
TypeBlog Post...Church lab uses this system to control expression of GFP.) To turn this inducible system into a repressible...expression system for sphingomonads and other Alphaproteobacteria. Appl Environ Microbiol. 2013 Nov;79(21):... -
Fluorescent Protein Guide: Biosensors
TypeCollection...Calcium erGAP3 (GFP-Aequorin Protein) for imaging of Ca+ dynamics in endoplasmic reticulum GFP-Aequorin Protein...and PDE5alpha. ACS Sens. 2017 Jan 27;2(1):46-51. Tetsuya Kitaguchi cGMP (cyclic GMP) FlincG3 (GFP-based...2020 GENIE Project Calcium jGCaMP7 High-performance GFP-based calcium indicators (Constitutive or Cre-dependent...cyclic AMP) Signaling reporter island (SiRI) with GFP-based fluorescent reporter cAMPr Spatial Multiplexing... FLAMP Plasmids Jun Chu cGMP (cyclic GMP) FlincG GFP-based cGMP sensor Differential patterning of cGMP... vascular smooth muscle cells revealed by single GFP-linked biosensors. Proc Natl Acad Sci U S A. 2008... C. elegans neurons Using a Robust and Sensitive GFP-Based cGMP Sensor for Real Time Imaging in Intact... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection... pCAG-SpCas9-GFP-U6-gRNA 79144 Mammalian hU6 yes, cut S. pyogenes EGFP Zou pCAG-eCas9-GFP-U6-gRNA 79145...Cerulean Church LRG (Lenti_sgRNA_EFS_GFP) 65656 Mammalian/Lentiviral LIC none S. pyogenes GFP Vakoc U6>sgRNA...cut Lb Cpf1 Neo Welker AIO-GFP 74119 Mammalian U6x2 yes, nick S. pyogenes EGFP Jackson AIO-mCherry 74120...pyogenes Zhang pL-CRISPR.EFS.GFP 57818 Mammalian/Lentiviral BsmBI yes, cut S. pyogenes EGFP Ebert pLKO.1-puro...pyogenes Zhang pLKO5.sgRNA.EFS.GFP 57822 Mammalian/Lentiviral BsmBI none S. pyogenes EGFP Ebert pSECC 60820...tagRFP657 Ebert pL-CRISPR.SFFV.GFP 57827 Mammalian/Lentiviral BsmBI yes, cut S. pyogenes EGFP Ebert pLKO5.sgRNA.EFS.tRFP...pyogenes Chen pdCas9-DNMT3A-EGFP 71666 Mammalian U6 yes, methylation S. pyogenes EGFP Zoldos pdCas9-DNMT3A-PuroR... -
Plan Your Experiment
TypeCollection...typically used for gRNA May contain reporter gene (e.g. GFP) to identify and enrich positive cells, or selection...transfer vectors May contain reporter gene (e.g. GFP) or selection marker to identify and enrich positive... Cas enzyme promoter can be constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically... -
Adenoviral Delivery of CRISPR/Cas9 Aims to Expand Genome Editing to Primary Cells
TypeBlog Post... pAdSh.PGK.Cas9, pAdSh.U6.gRNAS1, and pAdSh.U6.gRNAGFP. Gonçalves says that advantages of AdVs include...Sickle Cells Disease, Duchenne Muscular Dystrophy, Alpha1-antitrypsin deficiency (most widely used so far...guide RNA constructs, pAdSh.U6.gRNAS1 and pAdSh.U6.gRNAGFP, and also Adeno Cas9 and Adeno EA. Or if you're... -
Plan Your Experiment
TypeGuide...typically used for gRNA May contain reporter gene (e.g. GFP) to identify and enrich positive cells, or selection...transfer vectors May contain reporter gene (e.g. GFP) or selection marker to identify and enrich positive... Cas enzyme promoter can be constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically... -
Molecular Biology Reference
TypeGuide...contain a reporter gene (for example, luciferase or GFP) that offers a read-out of the activity of the genetic... common lab strains MG1655 and its derivatives DH5alpha and DH10b (also known as TOP10) among others, ...lacY1 proA2 rpsL20(StrR) xyl5 lambda- leu mtl1 DH5alpha Invitrogen F- Phi80lacZDeltaM15 Delta(lacZYA-argF...