Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 490 results for: ARA-2

Showing: 21 - 40 of 490 results

  1. Rett Syndrome

    Type
    Collection
    ... mutations in the gene methyl-CpG binding protein 2 ( MECP2 ). MECP2 Rett syndrome is an X-linked disorder...X-linked MECP2, encoding methyl-CpG-binding protein 2. Nat Genet . 23, 185–188. (Link opens in a new window... Cuddapah et al. 2014. Methyl-CpG-binding protein 2 (MECP2) mutation type is associated with disease severity... Specific mutations in methyl-CpG-binding protein 2 confer different severity in Rett syndrome. Neurology...males with mutations in Methyl-CpG binding protein 2. Am J Med Genet B Neuropsychiatr Genet . 180, 55–67... incidence of approximately 1:10,000. It is characterized by apparently normal development through the... database of clinical features and genetic characteristics of Rett syndrome (Link opens in a new window...

  2. Validated gRNA Sequences

    Type
    Collection
    ...23792628 Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...Mashimo Kit-2 R. norvegicus CTAACGTTCCAGCGCTCGTT 60970 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus... & Lim swan-2 C. elegans ACAAATTGATATCCAATCA 66100 cut S. pyogenes 25249454 Seydoux swan-2 C. elegans ...AMPK alpha 2 H. sapiens GTCAGCCATCTTCGGCGCGCG 74376 nick S. pyogenes 26816379 Shaw AMPK alpha 2 H. sapiens.... pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1 M. musculus AGCTCCTTCCCTGAGTGGCA 59912...25352017 Zaratiegui ade6-M210 S. pombe TCTATTGTTCAGATGCTTCG 52226 cut S. pyogenes 25352017 Zaratiegui ade6...TCTATTGTTCAGATGCCTCG 52225 cut S. pyogenes 25352017 Zaratiegui Alk and Eml M. musculus 64071 cut S. pyogenes...

  3. Lentiviral Prep Service

    Type
    Collection
    ...Barcode Library Version 2 Ready-to-use lentiviral particles carrying version 2 of the CellTag barcoding...barcoding library. Version 2 of the Celltag library contains 4934 barcodes to combinatorially index cells for...plasmid from us or receive a ready-to-use viral preparation from the inventory below. Lentiviruses are distributed... in a new window) . Please note this does not guarantee viral service, but lets us know what viruses would...

  4. Viral Production

    Type
    Collection
    ...suggests that titers obtained using ddPCR are generally 2–3 fold higher than those achieved using the standard...catalog item (see maps section for images). Figure 2: AAV Pro cells were transduced with either pAAV-Ef1a-mCherry-IRES-Cre... a new vial of early passage cells. Approximately 2 weeks post-thaw, cell culture supernatant is tested...specific virus in order to generate high quality preparations. After production, all virus preps are titered...plasmid encoding adenoviral helper sequences. AAV preparations are purified by iodixanol gradient ultracentrifugation...purity and titers adequate for in vivo studies. Preparations are then aliquoted and stored at -80 °C. Titer...on viral genomes isolated from the final AAV preparation. Sequencing results are analyzed to confirm the...

  5. Zhang Lab CRISPR Page

    Type
    Collection
    ...SpCas9n with 2a-Puro and 2a-EGFP are also available. 2. SpCas9 (or SpCas9n, D10A nickase) + CRISPR RNA array... system - lentiCRISPR - sgRNA and SpCas9 together 2 vector system - lentiCas9-Blast and lentiGuide-Puro...two MS2 RNA aptamers at the tetraloop and stemloop 2 The MS2-P65-HSF1 activation helper protein Full references...backbone with MS2 loops at tetraloop and stemloop 2 and EF1a-zeo resistance marker. Contains BsmBI sites...inverted terminal repeats (ITR) from AAV serotype 2. SaCas9 only: This plasmid ( PX600, #61592 ) contains...Epub 2013 Aug 29. Erratum in: Cell. 2013 Oct 10;155(2):479-80. PubMed . Genome engineering using the CRISPR-Cas9... Feng G, Sharp PA, Zhang F. Cell . 2014 Oct 9;159(2):440-55. doi: 10.1016/j.cell.2014.09.014. Epub 2014...

  6. Neurodegeneration Research Collection

    Type
    Collection
    ...different inherited genes: Presenilin 1, Presenilin 2, and APP gene.The majority (>90%) of individuals develop...study aggregation. Saha et al. Nat Commun. 2023 Feb 2. Study the C terminal domain of TDP-43 to better understand... rodent species. Boender et al. Sci Adv. 2023 Jun 2. Use Cas9 in astrocytes. Endo et al Science. 2022 ...with the iPSC toolbox . Lam et al. bioRxiv. 2022 Dec 2. Use PiggyBac plasmids with tet-inducible expression...Neurodegenerative diseases are a group of disorders characterized by the progressive degeneration and ultimate...biology of these diseases, rather than focusing on separate diseases, will help speed progress towards curing...

  7. Why Add Sucrose? Improved Yields for Adeno-associated Virus Preparation

    Type
    Blog Post
    ...bioengineering 94.2 (2006): 322-329. PubMed PMID: 16528756. 2. Oh, Steve KW, et al. "Substantial overproduction ...to be due to the viral particle’s affinity for heparan sulfate proteoglycans on the surface of the packaging...downstream applications scientists rely on our AAV preparations for, we wanted to be certain that this supplementation...the purity or infectivity of the final viral preparation. Through sugar detection assays, in vitro transduction...between the untreated and sucrose treated viral preparations.    Despite observing a positive effect on our...were, in fact, due to impaired endocytosis. In parallel assays designed to test the endocytosis of a fluorescent...

  8. mTOR Pathway

    Type
    Collection
    ...known as RPS6KB1; Ribosomal protein S6 kinase B1 TSC1/2 TSC1 TSC2 Tuberous sclerosis VHL Von Hippel-Lindau...Rictor RPTOR independent companion of MTOR, complex 2 SGK Serum/glucocorticoid regulated kinase 1 Return...disease. Laplante M, Sabatini DM. Cell. 2012 Apr 13;149(2):274-93. doi: 10.1016/j.cell.2012.03.017. PubMed PMID...mTORC2. Background mTORC1 & mTORC2 The better-characterized mTORC1 responds to various signals, including...

  9. Optogenetics AAV Preps

    Type
    Collection
    ...H134R)-EYFP CaMKII ChR2/H134R EYFP Constitutive 1, 2, 5, 9 Karl Deisseroth 26973 pAAV-hSyn-hChR2(H134R)...H134R)-EYFP Syn ChR2/H134R EYFP Constitutive 1, 2, 5, 9, rg*, PHPeB Karl Deisseroth 26975 pAAV-CaMKIIa-hChR2....WPRE.SV40 CAG ChR2/H134R mCherry Constitutive 1, 2, 5, 9 Karl Deisseroth 127090 pAAV-CAG-DIO-ChR2(H134R...pAAV-EF1α1.1-ChrimsonR-GFP EF1a ChrimsonR GFP Constitutive 2 Edward Boyden 124650 pAAV-CamKIIa-C1V1(t/t)-mScarlet-KV2.1...pAAV-hSyn-eNpHR 3.0-EYFP Syn eNpHR 3.0 EYFP Constitutive 2, 5 Karl Deisseroth 137151 pAAV-nEF-NpHR3.3-EYFP nEF...table and filters below to find ready-to-use AAV preparations of optogenetics plasmids available in Addgene's... viral prep format. Please note this does not guarantee viral vector packaging service, but lets us know...

  10. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...transcribed to make the pre-CRISPR RNA (pre-crRNA). (2) The pre-crRNA is processed into individual crRNAs...2015. Class 1 (Multi-subunit effector complex) Class 2 (Single multi-domain effector) Type I (Cas3) Type ... with unprecedented speed and specificity. Figure 2: An overview of CRISPR and NHEJ/HDR. The Cas9/gRNA...regulation of transcription in eukaryotes. Cell . 154(2):442-51. PMID: 23849981 Ishino Y, Shinagawa H, Makino...Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell . 163(3):759-71. PMID: 26422227...contiguous stretches of DNA known as CRISPR arrays. Separate Cas proteins then express and process the CRISPR...have homology to foreign DNA. Protospacers are separated by short palindromic repeat sequences. (1) The...

  11. Mammalian RNAi Tools

    Type
    Collection
    ...degrades the mRNA. RISC includes argonaute protein 2 (Ago2), which facilitates cleavage of the target. ... International Journal of Biomedical Science, 13 (2), 48–57. PubMed (Link opens in a new window) . Moore...Ebrahimi, M., Rashno, M. M., Abadi, S. J., & Gharagouzlo, E. (2017). Molecular mechanisms and biological...

  12. Biosensor AAV Preps

    Type
    Collection
    ...dependent 1, 2, 5, 9 Kim , GENIE 100836 pAAV.CAG.GCaMP6f.WPRE.SV40 CAG GCaMP6f none Constitutive 1, 2, 9 Kim..., Huebener , Rose 83899 pAAV-mDlx-GCaMP6f-Fishell-2 Dlx GCaMP6f none Constitutive 1, 9, rg* Fishell 100833...pAAV-CAG-NIR-GECO2G CAG NIR-GECO2G none Constitutive 1, 2, 9 Campbell Calcium Sensor: HaloCaMP1a 138327 pAAV-synapsin-HaloCaMP1a-EGFP....v857.PDGFR CAG iGluSnFr3 v857 none Cre dependent 2 Podgorski 234437 pAAV-syn-iGluSnFR4s-NGR-WPRE Syn ...pAAV-hSyn-GRAB_g5-HT3.0 Syn GRAB_g5-HT3.0 none Constitutive 1, 2, 8 Li No available items found to match all requested... viral prep format. Please note this does not guarantee viral vector packaging service, but lets us know...

  13. AAV Molecular Tools

    Type
    Collection
    ...constitutive Expression of the tet-off transactivator (tTA) 2 Viviana Gradinaru 99120 pAAV-ihSyn1-tTA Inducible ...receptor fused to GFP for studying cell ablation. 2 Thomas Jessell , Eiman Azim 45580 pAAV-flex-taCasp3...voltage-gated Na+ channel mNaChBac and (physically separate) tdTomato 8 Massimo Scanziani 34910 paavCAG-pre-mGRASP-mCerulean... viral prep format. Please note this does not guarantee viral vector packaging service, but lets us know...

  14. Zinc Finger Consortium: Zinc Finger Arrays

    Type
    Collection
    ...OPEN OPEN gGTCATCTGCcattcGAGGCGGACa REST corepressor 2 OZ553 and OZ554 OPEN OPEN gCTCACCATCtgttggaTGCGATGGAa...modification. Maeder ML et al. Mol Cell. . 2008. Jul 25. 31(2):294-301. PubMed PMID 18657511 . Oligomerized pool...activity of three-fold or greater in a well-characterized bacterial two-hybrid reporter system but have...

  15. CRISPR Guide

    Type
    Collection
    ...gRNA-containing plasmid, or 2-vector systems, in which Cas9 must be delivered separately. They can knockout, ...Browse Plasmids: Double-Strand Break (Cut) Figure 2: Overview of the NHEJ repair mechanism. Multiplex ...systems enable researchers to target anywhere from 2–7 genetic loci by cloning multiple gRNAs into a single...your experimental cell population (Figure 8E). In a 2-vector system, you’ll need to either co-infect with...the presence of infectious organisms (like SARS-CoV-2 ) and genetic mutations. Similar to Cas9 and Cas12...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...off-target effects by using a single Cas9 nickase and 2 different gRNAs, which bind in close proximity on ...

  16. Antibody Guide

    Type
    Collection
    ... unknown Monomer with a valency of 2 IgE Protects against parasites and is responsible for driving allergic...such as anaphylactic shock Monomer with a valency of 2 IgG The most abundant isotype in blood, also found...secondary immune response Monomer with a valency of 2 IgG1; IgG2; IgG3; IgG4 IgM Produced during the primary... ranging from antibody fragments (shown in Figure 2) to completely unrelated molecules. Examples include...used for assembling protein nanostructures. Figure 2: An antibody (IgG, far left) compared to alternative... can be used in the lab to quantify, identify, separate, and locate proteins of interest. The protein ...use antibodies to identify denatured proteins separated by size on an SDS-PAGE gel. Though relative quantification...

  17. Recombinase-based State Machines Enable Order-dependent Logic in vivo

    Type
    Blog Post
    ... (PLtetO), the TP901 gene downstream of the arabinose (Ara)-inducible promoter (PBAD), and the A118 gene...efficiently do RSMs work? We tested a two-input (ATc and Ara) RSM over a time series of increasing input exposure...certain states of interest. For example, in Figure 2 below we present a two-input, five-state GRSM register...linking RSM inputs to endogenous gene expression (2). Our paper (1) explains how to arrange attB-attP...Science. 353, aad8559 (2016). PubMed PMID: 27463678. 2. Green, Alexander A., et al. "Toehold switches: de-novo-designed...general would benefit from a more comprehensive characterization of the recombinases at our disposal.  Many...

  18. Plan Your Experiment

    Type
    Collection
    ...components (Figure 2), and the optimal system will likely depend on your cell type. Figure 2: Different delivery...either (1) a lack of gRNA and/or Cas9 expression or (2) a lack of efficient target cleavage in cells that...CRISPR-Based genome editing. Trends in Biotechnology , 36 (2), 173–185. https://doi.org/10.1016/j.tibtech.2017.11.006... Villalta, J. E., Chen, Y., Whitehead, E. H., Guimaraes, C., Panning, B., Ploegh, H. L., Bassik, M. C....

  19. Addgene Packaged on Request: Scope of Service

    Type
    Collection
    ...AAV6, AAV8, AAV11, or AAV Retrograde serotypes and 2 x 10 12 GC/mL for the AAV2 serotype, as titered by...through our Packaged on Request service, Addgene guarantees a titer of at least 4 x 10 12 GC/mL for the AAV1... you know that we don’t expect to produce our guaranteed titer, and will give you the option to proceed...proceed with your order, or not, without a guaranteed titer. Any titer expectations communicated by email ...email will supersede the general guarantees above. We will have our expert viral vector production team carefully...our viral production does not yield the titer guaranteed here or by email, Addgene will contact you to...carried out with our materials, Addgene cannot guarantee the function of any viral vector. Addgene performs...

  20. Optogenetics Plasmid Collection

    Type
    Collection
    ...optogenetic tool is the widely used Channelrhodopsin-2 (ChR2) from Chlamydomonas reinhardtii . ChR2 is a ... viral preps? We also offer ready-to-use AAV preparations of many optogenetics plasmids. ID Plasmid Description...
Showing: 21 - 40 of 490 results