...delivery of a double-stranded RNA (dsRNA) that matches the mRNA target sequence. The dsRNA can be delivered...

...PHPeB Dimidschstein No available items found to match all requested criteria. Please consider using fewer...

...resulting heteroduplex is resolved by the cell’s mismatch repair (MMR) system. Alternatively, if the edited...

...fluorophores - Andrew Fire Lab. Available with and without PATC, which diminishes epigenetic silencing in the germline...

...dependent 8, rg* Deisseroth No available items found to match all requested criteria. Please consider using fewer...

...Transfer Plasmid Addgene uses a rigorous barcode matching system that follows the sample from the DNA tube...

... gene families, HDR oligonucleotide design, and batch processing for designing genome-wide gRNA libraries...

...dependent 5, 9, rg* Wiegert No available items found to match all requested criteria. Please consider using fewer...

...can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Why does...

... , Nectow , Schmidt No available items found to match all requested criteria. Please consider using fewer...

...Gonatopoulos-Pournatzis 3rd Varies 8,594 No available items found to match all requested criteria. Please consider using fewer...

...none Constitutive 9 Li No available items found to match all requested criteria. Please consider using fewer...

...containing one or more mismatches. However, some ligases can ligate mismatches to a significant degree... Large purine:purine mismatches and most smaller pyrimidine:pyrimidine mismatches are typically worse ... pyrimidine:purine mismatches. Helix stability also plays some role, and mismatches with more hydrogen...of annealed mismatched substrates (expected to have a slightly lower Tm around the mismatch) over annealed...including substrates containing gaps or DNA base pair mismatches (8-11). For some applications, there cannot be...Ligase, can ligate nicks containing one or more mismatches near the ligation junction with high efficiency...ligated than those with few. For many ligases, G:T mismatches, with two hydrogen bonds and a base-pair size...

...to where a match occurred, and whether it was a full or partial match. For example, matches of a name ...website resources that best match a user’s query, and return the matching resources in an order that makes...filter for promoter “Syn”, that, when selected, will match variations present in the data such as synapsin,...synapsin, hsyn synapsin-1, human synapsin, hSynap. Matching We capture multiple variations of the same information...indices in order to support different kinds of matches: exact words, partial words, phrases, partial phrases...name in the depositor field will rank higher than matches of the same name in the publication field. Suggestions...inform the user that the terms they are typing have matches in a given category, and serve as a shortcut to...

...Aebischer 10881 pCCL cPPT PGK EGFP WPRE LTR H1 shSOD1mismatch SOD1 H1 ALS Patrick Aebischer 11442 pBabe bleo...Mix HNRNPA1 His T7 ALS Tanja Mittag 169719 A1-LCD Patchy HNRNPA1 His T7 ALS Tanja Mittag 170443 pCDH-EF1a-hDNAJC6...neuropathy Albert La Spada No available items found to match all requested criteria. Please consider using fewer...

...and thawed to produce a new batch once you’ve passaged your current batch too many times or you suspect... is an ATCC Outreach Scientist at LGC Group, London, which is the European distributor for ATCC. He studied...This post was contributed by ATCC Outreach Scientist Nick Amiss. Cell culture in the present day Cell...different researchers are free of contamination and match their original description. The oldest, largest,...repositories is the American Type Culture Collection aka ATCC where I work. It is virtually impossible to work...if you get your cells from a repository like the ATCC, there are times when it is important to check their...undergone and when to throw them away and thaw a new batch. The exact number of passages can vary between cells...

...efficiency between patch cable and implant. A steady stream of photons from the laser to the patch cable to the...procedure as implanting a guide cannula). A fiber optic patch cable is then connected from laser to ferrule to... light. Test your implant by connecting it to a patch cable connected to the laser and measuring its output...considerations apply to the polishing and preparation of the patch cable (although you may be able to purchase one ...connection of the ferrule implant to the laser with the patch cable (difficult to see the cable) and subsequent...performed in freely moving animals, the fiber optic patch cable must be the appropriate length for your specific...the full range of motion, a commutator allows the patch cable to connect to the laser and rotate 360° without...

...CRISPR genotyping. The most common options include mismatch cleavage assays, such as Surveyor™, T7E1, and ...not be adequate standards for validating edits.  Mismatch cleavage assays rely on pairing between the edited...hybridize, the nuclease can detect strands with mismatches and cleave them. The results are then visualized...Information Detection Limit Advantages Disadvantages Mismatch Cleavage Assay Not Provided 5% Inexpensive, simple...across the genome and pinpoint the location of mismatches based on the sequences of the genome and sgRNA...genome-wide search criteria are not exhaustive. Mismatch tolerance settings are often limited to off-target...also generally weighted by the position of the mismatch along the length of the gRNA given the stricter...

...the tools we found performed batch guide design, batch primer design or batch analysis. We wanted to relieve...web app that helps scientists design and analyze batches of CRISPR samples. We invite you to jump in and..., we enabled it to return guides and primers in batch, optimized for HDR. Compared to wealth of resources...Crispresso by Luca Pinello and Kendell Clement for batch analysis because of its ease-of-use and comprehensive... information from Crispresso plus a summary per batch. Ranking guides for HDR in-depth In other tools,...target and 0 being the weakest interaction due to mismatches between the guide and the DNA target. CFD scores...sequence inserted by HDR may inadvertently re-create a match for the active guide. With these constraints in ...

...the “seed” region of the RNA guide, where exact matches to the DNA target are essential for cleavage. Nucleotides...stringent recognition mechanism that can tolerate mismatches in this region. The crystal structure in Figure... Cas9 to unwind the DNA and check for sequence matches; a perfect guide RNA will do you no good if there...doesn’t mind if the PAM complementary strand is mismatched.   Figure 5: S. pyogenes Cas9 bound to...Cofsky et al., 2022; Osuka et al., 2018). Each matching DNA:RNA pair gives just enough stability for the... the next DNA base pair to be unwound. A mismatch within the 10-base seed sequence will destabilize the...mentioned above, however, Cas9 sometimes tolerates mismatches in the next 8-10 bases after perfect pairing ...