Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 35 results for: Beta-s

Clear keywords
Showing: 21 - 35 of 35 results

  1. Viral Vectors 101: AAV Variables That Matter

    Type
    Blog Post
    ...and happy optimizing!  Recommended Reading Issa, S. S., Shaimardanova, A. A., Solovyeva, V. V., & Rizvanov...Resources References Aschauer, D. F., Kreuz, S., & Rumpel, S. (2013). Analysis of Transduction Efficiency...10.1089/hum.2009.169 Dudek, A. M., Pillay, S., Puschnik, A. S., Nagamine, C. M., Cheng, F., Qiu, J., Carette... https://doi.org/10.1038/s41434-019-0075-6 Issa, S. S., Shaimardanova, A. A., Solovyeva, V. V., & Rizvanov...number of different cells. Promoters such as chicken-beta-actin or CAG can drive strong early gene expression...10.1371/journal.pone.0076310 Damdindorj, L., Karnan, S., Ota, A., Hossain, E., Konishi, Y., Hosokawa, Y.,...Fong, D. M., Mouravlev, A., Young, D., & O’Carroll, S. J. (2019). Astrocyte-selective AAV gene therapy through...

  2. Sequencing Primers

    Type
    Guide
    ...CTGGTCATCATCCTGCCTTT Rabbit beta-globin intron Forward Bglob-intron-R TTTGCCCCCTCCATATAACA Rabbit beta-globin intron...AATATACCTCTATACTTTAACGTC S. cerevisiae GAL1 promoter Forward Gal10pro-F GGTGGTAATGCCATGTAATATG S. cerevisiae GAL10...intron Reverse Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region Reverse CAT-R GCAACTGACTGAAATGCCTC... site Reverse pCAG-F GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids Forward pCasper-F...of WPRE Reverse XBG-R GACTCCATTCGGGTGTTC Xenopus beta-globin 3'UTR Reverse XEF1a TTTCGCCCTAACTTCGTGAT ... 5' GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter... of GFP Reverse GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter Forward GW-3' GCATGATGACCACCGATATG...

  3. Immunology Research Plasmids and Resources

    Type
    Collection
    ...inhibin, beta A EDF, FRP INHBB inhibin, beta B MGC157939 INHBC inhibin, beta C IHBC INHBE inhibin, beta E MGC4638...regulatory subunit B, beta isoform PPP3RL PRKCB protein kinase C, beta MGC41878, PKC-beta, PKCB, PRKCB1, PRKCB2...gonadotropin, beta polypeptide 7 CG-beta-a, FLJ35403, FLJ43118 CGB8 chorionic gonadotropin, beta polypeptide...Era, NR3A1 ESR2 estrogen receptor 2 (ER beta) ER-BETA, ESR-BETA, ESRB, ESTRB, Erb, NR3A2 ESRRA estrogen-related...factor, beta 1 CED, DPD1, TGFB, TGFbeta TGFB2 transforming growth factor, beta 2 MGC116892, TGF-beta2 TGFB3...catalytic, beta polypeptide DKFZp779K1237, MGC133043, PI3K, PI3KCB, PI3Kbeta, PIK3C1, p110-BETA PIK3CD phosphoinositide...

  5. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...Aguiar, M., Beausoleil, S. A., Paulo, J. A., Rinehart, J., Huttlin, E. L., & Gygi, S. P. (2022). A multi-...SupD Strain 68306 C321.ΔA.Δserb.Amp Plasmid 68305 Beta lactamase S68TAG Plasmid 68302 MBP-MEK1 S222TAG ... described in: Mohler, K., Moen, J. M., Rogulina, S., & Rinehart, J. (2023). System‐wide optimization ...Barber, K. W., Muir, P., Szeligowski, R. V., Rogulina, S., Gerstein, M., Sampson, J. R., Isaacs, F. J., & Rinehart...Aerni, H. R., J, N., MA, Haimovich, A. D., Rogulina, S., Isaacs, F. J., & Rinehart, J. (2015). A flexible... N. L., Barber, K. W., Ter Haar, C. M., Rogulina, S., Amrofell, M. B., Isaacs, F. J., Rinehart, J., & ...Heinemann, I. U., Rovner, A. J., Aerni, H. R., Rogulina, S., Cheng, L., Olds, W., Fischer, J. T., Söll, D., Isaacs...

  6. Plasmids 101: Shuttle Vectors

    Type
    Blog Post
    ...don’t always translate to eukaryotes. For example, beta-lactam antibiotics like penicillin and ampicillin... can be used across species, for example, in both S. cerevisiae and E. coli. Auxotrophic selection is ...

  7. Fluorescent Proteins 101: Fluorescent Protein Timers

    Type
    Blog Post
    ...human IPSCs into glucose-sensitive insulin-secreting beta-like cells." Nature communications 7 (2016). PubMed.... 5. Miyatsuka, Takeshi, Zhongmei Li, and Michael S. German. "Chronology of islet differentiation revealed...

  8. AAV Molecular Tools

    Type
    Collection
    ...232353 pAAV-DIO-BACE-HA Syn-driven, Cre-dependent Beta-Secretase to be expressed (1:1) with either ATLAS...Expression System Activity Serotype PI 51509 AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE Syn-driven, Cre-dependent...

  9. Ras Pathway

    Type
    Collection
    ...Catalytic subunit alpha B1,B2: non-catalytic subunit beta G1, G2, G3: non-catalytic subunit gamma PTEN Phosphatase...targets. Rajalingam K, Schreck R, Rapp UR, Albert S. Biochim Biophys Acta. 2007 Aug;1773(8):1177-95. PubMed...

  10. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...orthogonal nuclease-inactive Cas9's (dCas9) from S. pyogenes, N. meningitidis and S. thermophilus which have been...Structure Plasmids: ER mCherry-Sec61 beta BFP-Sec61 beta BFP-KDEL Rtn4a-GFP (tubular ER) Microtubules...favorite cells. Ma et al., Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112...620nm) portions of the spectrum. PhD student Benjamin S. Padman recently developed a mitochondrially-targeted...context. Chatterjee A et al. Proc Natl Acad Sci U S A. 2013 Jul 16;110(29):11803-8. Plasmid tools for...

  11. Cancer and the Immune System: Deciphering the Relationship

    Type
    Blog Post
    ...growth factor signals such as tumor growth factor beta (TGFβ) and IL-10 that suppress APCs. T cells that...avenues in healthcare.   References 1. Vinay, Dass S., et al. "Immune evasion in cancer: Mechanistic basis...

  12. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Ratiometric Sensor for Imaging Insulin Secretion in Single beta Cells. Cell Chem Biol. 2017 Apr 20;24(4):525-531...657. Douglas Kim , GENIE Project Calcium GCaMP6f/m/s calcium sensors for imaging neural activity (Constitutive...Calcium Intersectional viral expression of GCaMP6m/s in cells depdent on Cre, Flp, or Vcre Comprehensive... encoded fluorescent sensor. Proc Natl Acad Sci U S A. 2004 Dec 14;101(50):17404-9. Ca 2+ indicators based...genetically encoded sensors. Proc Natl Acad Sci U S A. 2011 May 3;108(18):7351-6. Amy Palmer Zinc Cytosolic...single GFP-linked biosensors. Proc Natl Acad Sci U S A. 2008 Jan 8. Wolfgang Dostmann cGMP (cyclic GMP)...Schaffer collateral synapses. Proc Natl Acad Sci U S A. 2018 May 7. pii: 1720648115. Katalin Torok Glutamate...

  13. No Llamas Required - Synthetic Nanobodies Against Membrane Proteins

    Type
    Blog Post
    ...Stohler P, Bocquet N, Hug MN, Huber S, Siegrist M, Hetemann L, Gera J, Gmür S, Spies P, Gygax D, Geertsma ER...Breedam W, Roose K, van Schie L, Hoffmann M, Pöhlmann S, Graham BS, Callewaert N, Schepens B, Saelens X, McLellan...Egloff P, Hutter CAJ, Kuhn BT, Bräuer P, Newstead S, Dawson RJP, Geertsma ER, Seeger MA (2020) Generation...Structural Basis for Potent Neutralization of Betacoronaviruses by Single-Domain Camelid Antibodies. Cell ...

  14. RNA Interference in Plant Biology: New Tools for an Old Favorite

    Type
    Blog Post
    ...processed miRNA or siRNAs then silence the target gene(s) either transcriptionally or post-transcriptionally...produced that contains sequence against your gene(s) of interest and the reporter. This approach greatly...Plant Biology 7:251–257 . https://doi.org/10.1055/s-2005-837597 Li J-F, Chung HS, Niu Y, Bush J, McCormack...F, Joberty G, Zinn N, Mueller WF, Clauder-Münster S, Eberhard D, Fälth Savitski M, Grandi P, Jakob P, ...positive selection of plants undergoing RNAi, and LIIbeta F 1-2 RNAi, which allows assembly of intron-spliced...

  15. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Hyman 89483 VN-beta Synuclein SNCB Venus CMV Lewy body dementia Tiago Outeiro 89484 beta Synuclein-VC SNCB...TDP43 RRM-GFP sigma-S TARDBP CMV ALS Rajat Rohatgi 107799 pHBS931 TDP43 RRM-GFP F-S TARDBP CMV ALS Rajat...TDP43 RRM-GFP FYW-S TARDBP CMV ALS Rajat Rohatgi 118792 pHBS1385 TDP43 RRM-GFP VLIM-S TARDBP CMV ALS Rajat...pHBS1410 GFP-TDP43 F-S TARDBP CMV ALS Rajat Rohatgi 118800 pHBS1411 GFP-TDP43 FYW-S TARDBP CMV ALS Rajat...BFP-P2A-TDP43 F-S] TARDBP CMV ALS Rajat Rohatgi 118809 pHBS1404 [IBB-GFP-mCherry 3E]-[BFP-P2A-TDP43 VLIM-S] TARDBP...SUMO-TDP43 F-S-TEV-mCherry TARDBP T5 ALS Rajat Rohatgi 133322 pHBS1552 H14-SUMO-TDP43 FYW-S-TEV-mCherry...-TDP43 F-S] TARDBP CMV ALS Rajat Rohatgi 133329 pHBS1505 [IBB-GFP-mCherry3E]-[BFP-TDP43 FYW-S] TARDBP ...
Showing: 21 - 35 of 35 results