We narrowed to 144 results for: MYC
-
TypeBlog Post...Figure 1: A) Cell-penetrating Cas9, fused to HIV TAT, Myc and SV40 Nuclear Localization Signals, and GFP. B...
-
Starter guide to induced pluripotent stem cells (iPSCs) part 1: A renaissance in regenerative medicine
TypeBlog Post...of four embryonic genes- OCT4, SOX2, KLF4, and C-MYC. iPSCs were first generated from mouse fibroblasts... -
Fluorescent Tagging of Endogenous Genes with SapTrap
TypeBlog Post... T2A-TurboGFP-PEST), and small epitope tags (HA, Myc, Strep tag II, AviTag, HaloTag, SpyTag). The Foerstemann...YFP, Strep, TEV-V5) with either blasticidin or puromycin selection. Researchers at the Allen Institute ... -
How to Write a Scientific Review Article
TypeBlog Post... you casually mention “Haery et al., showed that MYC expression was increased…” when discussing the review... -
Neuronal labeling with Spaghetti Monster
TypeBlog Post...hemagglutinin (HA), myelocytomatosis viral oncogene (myc), simian virus 5-derived epitope (V5), the synthetic... -
Antibodies 101: Immunoprecipitation
TypeBlog Post...target. In cases such as this, an epitope such as c-Myc, GFP or V5 can be used to tag the protein of interest... -
Ginkgo Bioworks COVID-19 Collection
TypeCollection... mammalian) Tags (e.g. 6xHis, Flag, StrepII, HA, Myc, SUMO, GST, MBP, CBP, S-tag, TAP tag, TRX, or V5)... -
Luciferase Plasmid Collection
TypeCollection...Mammalian expression of Nanoluc with a N-terminal Myc tag Erich Wanker 124701 pLenti-PGK-Venus-Akaluc (...Lentiviral expression of Nanoluc with a N-terminal Myc tag Erich Wanker 115352 pFL-SV40 Firefly SV40 Mammalian...five transcriptional reporters for NF-kb, TGF-b, c-Myc, p53, and MAPK/JNK plus a constitutive control. Koen...FRB-Nluc : Split firefly luciferase reporter of rapamycin-inducible interaction. nLuc and cLuc : Constructs... -
All Antibodies
TypeCollection...popular markers like tubulin or epitope tags like Myc, GFP, and more. Neuroscience : Antibodies targeting... -
Hot Plasmids: Spring 2025
TypeBlog Post...known regulators at the FOS gene promoter and the MYC locus (Figure 5). Figure 5: TurboCas protein...lentiviral supernatant and selected with puromycin. Puromycin-resistant cells were fixed and labeled with...or C-terminal HA tag. Selectable and stable: A puromycin resistance gene makes stable cell line creation... -
Sequencing Primers
TypeGuide... promoter, forward primer Myc GCATCAATGCAGAAGCTGATCTCA (BD Biosciences) Myc tag, forward primer Neo-F ... end of neomycin resistance gene, forward primer Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance...primer Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene, forward primer pZIP TCCTTTCCAGCGAGGTTCTA... -
Hassle-free 96-well Format Epitope Tagging Using Cas9 Ribonucleoprotein
TypeBlog Post...crRNA and/or try out an alternative tag (3xFLAG, Myc, V5, or HA). Tag-specific PCR genotyping can tell... -
Tetracycline Inducible Expression
TypeCollection...inducible expression of mouse Oct4, Sox2, Klf4, and Myc for iPS cell generation Rudolf Jaenisch 51543 FUW-tetO-hOKMS...inducible expression of human Oct4, Sox2, Klf4, and Myc for iPS cell generation Tarjei Mikkelsen 172115 PB-TO-hNGN2...expression of shRNA with puromycin selection. See Plasmid #21916 for neomycin selection. TetR H1-2O2 Dmitri... with puromycin selection. See Plasmid #85973 for blasticidin and Plasmid #85972 for hygromycin selection...inducible expression; insert with Gateway cloning and puromycin selection rtTA-Advanced Tight TRE David Root 100521...blasticidin selection. See Plasmid #26730 for hygromycin selection. rtTA3 Eric Campeau 128061 pLVX-Tet3G... -
Zebrafish Plasmid Collection
TypeCollection...either amino- or carboxyl-terminal tags, including Myc, HA, Flag, GST and eGFP epitopes. Zebrafish Tol2 ... -
Prime Editing: Adding Precision and Flexibility to CRISPR Editing
TypeBlog Post...expression ~ ~ ~ ~ ✓ ✓ SV40 and c-Myc nuclear localization sequences Improve translocation... -
Cre-lox system
TypeCollection...Cepko 13779 pRho-Cre Cre-Myc rhodopsin Mammalian Cepko 13780 pNrl-Cre Cre-Myc, Expressed in rod photorecetor...recombinant Cre Bacterial Rajewsky 13775 pCAG-Cre Cre-Myc CAG Mammalian Cepko 13776 pCAG-Cre:GFP Cre-GFP fusion...Capecchi 116879 CAG-Cremyc-2A-GFP GFP and Cre CAG Mammalian Lu 117148 Hiv7CMV-Cremyc-2A-GFP GFP and Cre... -
28 Hot Plasmid Technologies from 2015
TypeBlog Post...while there are many types of epitope tags (eg. HA, MYC, Flag), they can be deleterious and cause aberrant...them to popularly used epitopes tags such as HA and MYC in vivo. The authors found that fusions to one particular...fragment with FKBP rapamycin binding domain of mTor (Cas9(N)-FRB-NES) resulting in a rapamycin-inducible Cas9...Addgene: Rapamycin-inducible Cas9 sets (Addgene plasmids 62883 &62884; 62885 & 62886) Rapamycin-inducible...separate reporter gene (EGFP, iRFP, IFP1.4, puromycin, neomycin or luciferase) to create a final lentiviral...Cas9 for genome editing. Without rapamycin treatment, the Cas9(N)-FRB-NES fragment is actively shuttled...to the nuclear export sequence. Treatment with rapamycin induces Cas9(N)-FRB-NES and Cas9(C)-FKBP-2xNLS... -
Bacterial Expression Systems
TypeCollection... include: Epitope tags: 6xHis, Flag, Strep II, c-Myc, HA, V5, GST Solubility tags: MBP, SUMO, TrxA, Mocr...Lu 17972 pSE100 Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium tuberculosis Sabine...Ehrt 44561 pST-KT Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium tuberculosis Vinay...Acetamide Escherichia coli , Mycobacterium smegmatis Matthias Wilmanns 84692 pMyC-kan Acetamidase promoter... PnitA-NitR ε-caprolactam Escherichia coli , Streptomyces sp. Xuming Mao 46888 pMSP3545 PnisA Nisin Escherichia...promoter Acetamide Escherichia coli , Mycobacterium smegmatis Matthias Wilmanns 84689 pMyBADC-kan pBAD Arabinose...Arabinose Escherichia coli , Mycobacterium smegmatis Matthias Wilmanns 17806 pPro18 pPrpB Propionate Escherichia... -
CRISPR Pooled gRNA Libraries
TypeCollection...Knockout Library 171531 Knockout Human Li 3rd ~6 9,274 MYC-CRISPR Library 173195 Knockout Human Dzikiewicz-Krawczyk...1000000074 (Puromycin) Activation Human Zhang 3rd 3 70,290 SAM v1 - 3 plasmid system 1000000075 (Puromycin) Activation...Library 159391 Knockout Mouse Moffat 3rd 4 182 Mycobacterium tuberculosis CRISPRi Library (RLC12) 163954 ...Inhibition M. tuberculosis Rock NA Varies 96,700 Mycobacterium smegmatis CRISPRi Library (RLC11) 163955 Inhibition... -
Molecular Biology Reference
TypeGuide...Acid Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL V5 GKPIPNPLLGLDST Xpress DLDDDDK or DLYDDDDK...EtOH) 25 µg/mL Hygromycin B 200 mg/mL 200 µg/mL Kanamycin 50 mg/mL 50 µg/mL Spectinomycin 50 mg/mL 50 µg...