We narrowed to 43 results for: MYC

... transcription factors OCT3/4, SOX2, KLF4, and c-MYC is the established model for reprogramming somatic...article have been deposited with Addgene and include MYC- and FLAG-tagged TZAP constructs (wild-type and truncation...

...Figure 1: A) Cell-penetrating Cas9, fused to HIV TAT, Myc and SV40 Nuclear Localization Signals, and GFP. B...

...of four embryonic genes- OCT4, SOX2, KLF4, and C-MYC. iPSCs were first generated from mouse fibroblasts...

... T2A-TurboGFP-PEST), and small epitope tags (HA, Myc, Strep tag II, AviTag, HaloTag, SpyTag). The Foerstemann...

...target. In cases such as this, an epitope such as c-Myc, GFP or V5 can be used to tag the protein of interest...

...hemagglutinin (HA), myelocytomatosis viral oncogene (myc), simian virus 5-derived epitope (V5), the synthetic...

... you casually mention “Haery et al., showed that MYC expression was increased…” when discussing the review...

... mammalian) Tags (e.g. 6xHis, Flag, StrepII, HA, Myc, SUMO, GST, MBP, CBP, S-tag, TAP tag, TRX, or V5)...

...Mammalian expression of Nanoluc with a N-terminal Myc tag Erich Wanker 124701 pLenti-PGK-Venus-Akaluc (...Lentiviral expression of Nanoluc with a N-terminal Myc tag Erich Wanker 115352 pFL-SV40 Firefly SV40 Mammalian...five transcriptional reporters for NF-kb, TGF-b, c-Myc, p53, and MAPK/JNK plus a constitutive control. Koen...

...popular markers like tubulin or epitope tags like Myc, GFP, and more. Neuroscience : Antibodies targeting...

...CAGCACAAAAGGAAACTCACC Mouse U6 promoter Forward Myc GCATCAATGCAGAAGCTGATCTCA Myc tag Forward Neo-F CGTTGGCTACCCGTGATATT...

...known regulators at the FOS gene promoter and the MYC locus (Figure 5). Figure 5: TurboCas protein...

...inducible expression of mouse Oct4, Sox2, Klf4, and Myc for iPS cell generation Rudolf Jaenisch 51543 FUW-tetO-hOKMS...inducible expression of human Oct4, Sox2, Klf4, and Myc for iPS cell generation Tarjei Mikkelsen 172115 PB-TO-hNGN2...

...either amino- or carboxyl-terminal tags, including Myc, HA, Flag, GST and eGFP epitopes. Zebrafish Tol2 ...

...crRNA and/or try out an alternative tag (3xFLAG, Myc, V5, or HA). Tag-specific PCR genotyping can tell...

...pAAV-EFS-SpCas9 EFS-driven, constitutive Expression of Myc-tagged SpCas9. 8 Ryohei Yasuda Labeling Tools These...

...well-characterized epitope tag antibodies (Anti-c-Myc [9E10] for mouse and Anti-HA [12CA5] for rat) into...

...expression ~ ~ ~ ~ ✓   ✓ SV40 and c-Myc nuclear localization sequences Improve translocation...

...Sci Transl Med. 2013) Express human DNMT1 with a Myc tag. (Li et al. J Biol Chem. 2006) Express human ...

...while there are many types of epitope tags (eg. HA, MYC, Flag), they can be deleterious and cause aberrant...them to popularly used epitopes tags such as HA and MYC in vivo. The authors found that fusions to one particular...