We narrowed to 65 results for: c myc del 2
-
TypeBlog Post...hemagglutinin (HA), myelocytomatosis viral oncogene (myc), simian virus 5-derived epitope (V5), the synthetic...experiment using smFPs and standard neuronal tracers. 2. Visualization of neuronal sub-cellular structures...similar proteins. For example, N-cadherin (cadherin-2) is a postsynaptic cell adhesion protein that plays...PMID: 25915120. PubMed Central PMCID: PMC4573404. 2. Shepherd, G.M. (2004). In "The synaptic organization...pdb-top63. PubMed PMID: 20150100. 4. Shaner, Nathan C., George H. Patterson, and Michael W. Davidson. "Advances...recombinant Adeno-associated virus (AAV) has been widely used to deliver genetic tools to the brain because of its...together with the development of methodologies to deliver genes to the CNS have recently made it much easier...
-
Hot Plasmids February 2024
TypeBlog Post...Figure 1: A) Cell-penetrating Cas9, fused to HIV TAT, Myc and SV40 Nuclear Localization Signals, and GFP. B...mChe), with co-incubation with assist peptide (AP). C) Workflow for Cas-RNP-PAGE editing of primary T cells...overview of these new variants: Figure 2: Inner mitochondrial membranes imaged with structured...non-invasive systemic gene delivery in non-human primate (NHP) brains. Systemic gene delivery capsids previously...transfer in primate brains Endothelial-specific AAV delivery Recombinant anti-FLAG tag antibodies Peptide-assisted...addressed this problem by optimizing the Cas protein delivery with Peptide-Assisted Genome Editing (PAGE). They...due to its long, negatively charged sgRNA), RNP delivery was much better with Cas12, which uses a much ... -
CRISPR Pooled gRNA Libraries
TypeCollection...plasmid) 73633 (2 plasmid) Knockout Mouse Doench and Root 3rd 4 78,637 Broad GPP Humagne Set C and Humagne...Humagne Set D 172650 (Set C) 172651 (Set D) Knockout Human Doench and Root 2nd 2 40,710 Inzolia Human CRISPR...3rd 1, 2, or 4 49,766 arrays Broad GPP kinome Brunello 75314, 75315 (1 plasmid) 75312, 75313 (2 plasmid...Knockout Library 171531 Knockout Human Li 3rd ~6 9,274 MYC-CRISPR Library 173195 Knockout Human Dzikiewicz-Krawczyk...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...pneumoniae M. tuberculosis M. smegmatis Green monkey ( C. sabaeus ) Kaposi's Sarcoma-associated Herpes Virus...GPP genome-wide Brunello 73179 (1 plasmid) 73178 (2 plasmid) Knockout Human Doench and Root 3rd 4 76,441... -
Tetracycline Inducible Expression
TypeCollection...opens in a new window) Krueger, C., Pfleiderer, K., Hillen, W., & Berens, C. (2004). Tetracycline derivatives...inducible expression of mouse Oct4, Sox2, Klf4, and Myc for iPS cell generation Rudolf Jaenisch 51543 FUW-tetO-hOKMS...inducible expression of human Oct4, Sox2, Klf4, and Myc for iPS cell generation Tarjei Mikkelsen 172115 PB-TO-hNGN2...vector to express Tet-On 3G transactivator under the c-Fos promoter Tet-On 3G rtTA Bong-Kiun Kaang 20342 ...hSyn promoter rtTA3 Wei Xu 26803 pEnt L1L3 EF1a-tTA-2 Gateway entry vector to express tTA from EF1α promoter... N., Schambach, A., Galla, M., Maetzig, T., Baum, C., Loew, R., & Schiedlmeier, B. (2011). Retroviral ...expression and improved dynamic range . Hum Gene Ther, 22 (2), 166–176. https://doi.org/10.1089/hum.2010.099 (Link... -
28 Hot Plasmid Technologies from 2015
TypeBlog Post... Cas9 into n-terminal (Cas9(N)-2xNLS) and c-terminal (Cas9(C)-2xNLS) fragments facilitates target DNA ...activation, the c-terminal cas9 fragment was fused with FK 506 binding protein 12 (Cas9(C)-FKBP-2xNLS) and...many types of epitope tags (eg. HA, MYC, Flag), they can be deleterious and cause aberrant protein folding...export sequence. Treatment with rapamycin induces Cas9(N)-FRB-NES and Cas9(C)-FKBP-2xNLS dimerization and... with shRNA or shRNA-miR30, (2) tamoxifen-inducible CreERT2 gene deletion, (3) simultaneous expression...them to popularly used epitopes tags such as HA and MYC in vivo. The authors found that fusions to one particular...an n-terminal DNA recognition domain and a mostly c-terminal nuclease domain. Feng Zhang's group utilized... -
Five Popular Model Organisms
TypeBlog Post...an ortholog in C. elegans making it ideal to study basic molecular biology processes. C. elegans are also...PMCID: PMC5525645. Mello, Craig C., et al. "Efficient gene transfer in C. elegans: extrachromosomal maintenance...variety of environmental conditions, and double every 2 hours. Yeast are also the first eukaryotic genome ...lab to study neuronal development (Brenner, 1973). C. elegans are small, transparent worms that have a ...life cycle and large brood sizes. The majority of C. elegans are also self-fertile hermaphrodites making... Nobel Prize in 2006. One of major advantages of C. elegans is that they are transparent throughout their...GCaMP6 (Nguyen et al., 2015). If you are interested in C. elegans plasmids and resources check out Addgene’... -
CRISPR 101: Cytosine Transversion Editors
TypeBlog Post...transversions C → TG → A A → GT → C C → G C → AG → C G → T A → C ...Rosser, S. J., Bi, C., & Zhang, X. (2021). Glycosylase base editors enable C-to-A and C-to-G base changes...deaminase could also perform cytidine (C) deamination, converting the C base to uracil (U). This is the same...given the pithier name CGBE1, for “C → G Base Editor 1,” and had a C → G editing efficiency of up to 68%...Beyond UNG: Optimizing C → G editors Now that several labs had shown that preferential C → G editing was possible...pyrimidines (C ↔ T). Base transversion Base changes from purine (A or G) to pyrimidine (C or T) or vice-versa...type of base editor invented. CGBE C → G Base Editor Converts C → G; also called a glycosylase base ... -
Hot Plasmids: Fall 2024
TypeBlog Post...improve solubility and stability (Figure 2). Figure 2: Crystal structures of CRBNmidi alone... 228(2), iyae126. https://doi.org/10.1093/genetics/iyae126. Gene disruption in Mycobacterium abscessus...Optimized mScarlet-based tags for live imaging in C. elegans CRISPR/Cas9 for gene disruption in M. abscessus...tagging proteins, as it can be fused to the N- or C-terminus (or even in the middle of proteins) and performs.... E., Young, D. F., Goswami, K. K., & Russell, W. C. (1987). Isolation and characterization of monoclonal...39406745. Optimizing mScarlet tags for live imaging in C. elegans By Alyssa Neuhaus Red fluorescent proteins...maturation rate limits its use in systems like the C. elegans embryo, where developmental processes happen... -
Validated gRNA Sequences
TypeCollection... Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...& Lim swan-2 C. elegans ACAAATTGATATCCAATCA 66100 cut S. pyogenes 25249454 Seydoux swan-2 C. elegans TGAAGAAAGTTATACTCGA...Yamamoto avr-14 C. elegans GATTGGAGAGTTAGACCACG 58981 cut S. pyogenes 24879462 Mello avr-15 C. elegans GTTTGCAATATAAGTCACCC...Katic dpy-10 C. elegans GCTACCATAGGCACCACGAG 59933 cut S. pyogenes 25161212 Fire dpy-10 C. elegans TCCGCTACCATAGGCACCA...Sabatini K08F4.2 C. elegans AATCACTCCCTGTTTGTGT 66085 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans CACGAGGTGGTATGCGCAG...Seydoux K08F4.2 C. elegans CGCAGCGGTTTCCAAAATG 66092 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans GCCTTAACCCAGAATAAGA...Mashimo Kit-2 R. norvegicus CTAACGTTCCAGCGCTCGTT 60970 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus... -
Plasmids 101: Repressible Promoters
TypeBlog Post...combined the system with Flp/FRT, as reviewed by del Valle Rodriguez et al. LexA/lexAop A second binary...Find plasmids from this publication at Addgene. del Valle Rodriguez, Alberto, Dominic Didiano & Claude...engineering applications in Saccharomyces cerevisiae.” FEMS Yeast Res. 12(2) (2012): 197-214. PubMed PMID...also shown that the Q system is also functional in C. elegans. Subsequent work by the Luo and Potter labs...immediate early gene expression. Genes Dev. 1988 Jun;2(6):718-29. doi: 10.1101/gad.2.6.718. PMID: 2843425...23995928; PMCID: PMC3811519.Seo SO, Schmidt-Dannert C. Development of a synthetic cumate-inducible gene ...Targeted Gene Expression in Drosophila.” Genetics 186(2) (2010): 735-55. PubMed PMID: 20697123. PubMed Central... -
27 Hot Plasmids from 2016
TypeBlog Post... 79628 (C) Cv (capsid) N and C 79633 (N) and 79641 (C) NS1 (var: W98G) N and C 79635 NS3 C 79637...79637 NS2B C 79636 NS4A N 79640 NS4B C 79639 NS5 C 79632 (N) and 79631 (C) PrM N and C Detecting...tagged BioID2 for N-terminal fusions and Myc tagged BioID2 for C-terminal fusions. Kim, et al. Mol Biol...expressed gRNAs respectively) and 2) the size of the deletion. Smaller deletions generally occurred at higher...backbone, which expresses the gRNA from a Drosophila U6:2 promoter and Cas9 from the actin 5C promoter. Addgene...backbones for lentivirus LV 1-5 and retrovirus RV 2-5 were constructed. The authors then used GMAP assembly...engineering (MAGE) (1). MAGE uses recombineering (2) to simultaneously incorporate multiple single-strand... -
Quickest Way to Deposit Plasmids: The Deposit Spreadsheet
TypeBlog Post...difficult to grow. Growth Temp Choose from 30 °C, 37 °C, or room temperature. Growth Strain Please...our deposit spreadsheet to complete Step 1. Steps 2 and 3 are usually very easy — our tech transfer team...columns are shown in red in the spreadsheet (Figure 2) and are described in Table 1. Some cells have drop-down...frog), D. rerio (zebrafish), D. melanogaster (fly), C. elegans (nematode), S. cerevisiae (budding yeast)...Filling out and sending the deposit spreadsheet Figure 2: Example of the deposit spreadsheet showing the first... gentamicin, hygromycin, kanamycin, nourseothricin (clonNat), spectinomycin, streptomycin, tetracycline...exceptions to our standard workflow. Table 1: Guidelines for the data fields in the deposit spreadsheet... -
Harnessing TnpB for Genome Editing: A Compact and Versatile Tool for Your Research
TypeBlog Post...Oligo 2 to screen. A 667-bp product confirms successful insertion. Step 6: Confirmation Pick 2–3 positive...doi.org/10.1038/s41587-019-0337-2 Molla, K. A., Sretenovic, S., Bansal, K. C., & Qi, Y. (2021). Precise ...can use TEEP — a tool based on animal data. Step 2: Prepare Oligos Oligo 1: Add 'tcaa' to the 5′ end...your forward guide sequence (see Figure 1). Oligo 2: Add 'ggcc' to the 5′ end of your reverse complement...Primer 92F (5′-cattacgcaattggacgacaac-3′) and Oligo 2 (specific to your target) to screen colonies via PCR...Maher, M. F., Nasti, R. A., Vollbrecht, M., Starker, C. G., Clark, M. D., & Voytas, D. F. (2019). Plant gene...Gao, Q., Liu, S., Zhang, X., Hu, W., Wang, Y., Han, C., Li, D., & Wang, X. (2025). Transgene- and tissue... -
Plasmids 101: Choosing an Antibiotic Resistance Gene
TypeBlog Post...jcm.23.5.959-961.1986 Lobstein, J., Emrich, C. A., Jeans, C., Faulkner, M., Riggs, P., & Berkmen, M. (2012...antibiotic selection. Essentially, this gene is a 2-in-1 providing both bacterial and eukaryotic selection...References Hwang, J. M., Piccinini, T. E., Lammel, C. J., Hadley, W. K., & Brooks, G. F. (1986). Effect...Zeocin-induced DNA cleavage in human cells. Mutagenesis, 20(2), 111–114. https://doi.org/10.1093/mutage/gei016I ...Slow transformation Spectinomycin/streptomycin Spectinomycin and streptomycin both inhibit protein synthesis...isn’t a widely popular selection agent. Pros: Stable (spectinomycin). Cons: Cost (spectinomycin) or stability... for transformations. Con: Expensive. Kanamycin Kanamycin, or kan, is an aminoglycoside which inhibits... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...EGFP Del Bene pUAS:Cas9T2ACre;U6:sgRNA1;U6:sgRNA2 74010 Zebrafish U6 yes, cut S. pyogenes Cre Del Bene...Cas9 + Empty sgRNA) 47549 C. elegans yes, cut S. pyogenes Goldstein DR274 42250 C. elegans BsaI none S. pyogenes...pyogenes URA3 Wyrick pCRISPomyces-2 61737 Bacteria BbsI yes, cut S. pyogenes Apramycin Zhao pRB1017 59936...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...pyogenes Zhang PX854 62886 Mammalian BbsI yes, cut, C-terminal S. pyogenes Zhang pGuide 64711 Mammalian ...pyogenes Zhang PX852 62884 Mammalian BbsI yes, cut, C-terminal S. pyogenes Zhang PX855 62887 Mammalian BbsI... -
Advanced Uses of Cre-lox and Flp-FRT - A Neuroscientist’s View
TypeBlog Post...optimum of 30 °C and is therefore inefficient in mammalian cells (usually grown at 37 °C). Smart molecular...Sadowski. 1985. “The FLP Recombinase of the Saccharomyces Cerevisiae 2 Micron Plasmid Attaches Covalently to...identification of FLPe which has a temperature optimum of 37 °C (Buchholz, Angrand, and Stewart 1998). FLPe’s performance... receptor (ER) ligand binding domain (LDB) to the C-terminus of FLP or Cre (pCAG-CreERT2 #14797). These...FLP and Cre for additional control Figure 2: Expression of a morphological marker (eYFP) and synaptic...Sternson. 2008. “A FLEX Switch Targets Channelrhodopsin-2 to Multiple Cell Types for Imaging and Long-Range ...PMID: 18614669. PubMed Central PMCID: PMC2593125. 2. Buchholz, F, P O Angrand, and A. Francis Stewart.... -
CRISPR Methods for Bacteria: Genome Engineering, CRISPRa, CRISPRi, Base Editing, and More
TypeBlog Post..., while pCRISPomyces-2 contains Cas9 and a gRNA cassette. The simpler system of pCRISPomyces-2 displays...and a subsequent curing protocol that requires only 2-3 hours incubation. E. coli and T. citrea scarless...four major components including (1) a CRISPR RNA, (2) four proteins forming the QCascade DNA-targeting ... of cytidine and adenine base editors that enable C-to-T and A-to-G base substitutions respectively. Substitutions...:723–728 . https://doi.org/10.1021/sb500351f Dong C, Fontana J, Patel A, Carothers JM, Zalatan JG (2018... https://doi.org/10.1016/j.cell.2013.02.022 Ronda C, Pedersen LE, Sommer MOA, Nielsen AT (2016) CRMAGE...Vridhambal GS, Rivera AJ, Montgomery SA, Fortier L-C, Barrangou R, Theriot CM, Ousterout DG (2020) In Vivo... -
Tips for Screening with Yeast Two Hybrid Systems
TypeBlog Post...El-Bakkoury, M., Hamacher, T., Cappellaro, C., Vilarino, C., Fleischer, C., Ellerbrok, H., Kamuzinzi, R., Ledent... systems available in model organisms, including bacteria, alternative fungi (C. albicans, pC2HB) (7) ...retain their individual activities when separated (2), and that DBD and TAs from different systems could... prey libraries can be screened using both N- and C-terminal fusions of these proteins. This way both ... Enzymol. 1983;100:293-308. PubMed PMID: 6312261. 2. Keegan, L., Gill, G., and Ptashne, M. Separation ...Two hybrid systems were developed in Saccharomyces cerevisiae in 1989 and are still used extensively ... -
Fluorescent Proteins 101: Photoactivatable Fluorescent Proteins
TypeBlog Post...fluorescent state make them useful for 2-color imaging with green PA-FPs. Table 2: Properties of Selected Reversible... conventional FP imaging. PA-FPs are divided into 2 main categories - those with irreversible and reversible... forms of the chromophore which contribute to the 2 peaks of wtGFP’s excitation spectrum- a major 397 ... / N99K / S148L / I165V / Q167P / L169V / I203R) (2) and PA-mRFP1(S146H / I161V / I197H) (3) were derived...mEosFP’s chromophore requires a temperature below 30°C and this is not ideal for experiments in mammalian...can form it’s chromophore at a more comfortable 37°C (5). Dendra2 photoconverts from green to red fluorescence...with two distinct wavelengths of light (see Table 2). The best known reversible PA-FP is the naturally... -
SARS-CoV-2 Pseudotyped Virus
TypeCollection...production, including codon optimization, deletion of the C-terminal 18-21 amino acids and a D614G change...pseudotyping with SARS-CoV-2 spike protein. Collections... Collections COVID-19 - Viral Pseudotyping SARS-CoV-2 Pseudotyped Virus...Virus Mechanisms of SARS-CoV-2 infection remain poorly understood but are critical for developing therapeutic...spread. As a Biosafety Level 3 (BSL-3) agent, SARS-CoV-2 requires specialized facilities for the study of the...replication-defective virus particles with the SARS-CoV-2 spike (S) glycoprotein on the envelope surface. Pseudotyped... express ACE2, the cellular receptor for SARS-CoV-2, in a single round of viral entry and infection. This...