Skip to main content

We narrowed to 138 results for: myc

Showing: 21 - 40 of 138 results
  1. Fluorescent Tagging of Endogenous Genes with SapTrap

    Type
    Blog Post
    ... T2A-TurboGFP-PEST), and small epitope tags (HA, Myc, Strep tag II, AviTag, HaloTag, SpyTag). The Foerstemann...YFP, Strep, TEV-V5) with either blasticidin or puromycin selection. Researchers at the Allen Institute ...
  2. Hot Plasmids February 2024

    Type
    Blog Post
    ...Figure 1: A) Cell-penetrating Cas9, fused to HIV TAT, Myc and SV40 Nuclear Localization Signals, and GFP. B...
  3. Luciferase Plasmid Collection

    Type
    Collection
    ...Mammalian expression of Nanoluc with a N-terminal Myc tag Erich Wanker 124701 pLenti-PGK-Venus-Akaluc (...Lentiviral expression of Nanoluc with a N-terminal Myc tag Erich Wanker 115352 pFL-SV40 Firefly SV40 Mammalian...five transcriptional reporters for NF-kb, TGF-b, c-Myc, p53, and MAPK/JNK plus a constitutive control. Koen...FRB-Nluc : Split firefly luciferase reporter of rapamycin-inducible interaction. nLuc and cLuc : Constructs...
  4. All Antibodies

    Type
    Collection
    ...popular markers like tubulin or epitope tags like Myc, GFP, and more. Neuroscience : Antibodies targeting...
  5. Hot Plasmids: Spring 2025

    Type
    Blog Post
    ...known regulators at the FOS gene promoter and the MYC locus (Figure 5). Figure 5: TurboCas protein...lentiviral supernatant and selected with puromycin. Puromycin-resistant cells were fixed and labeled with...or C-terminal HA tag. Selectable and stable: A puromycin resistance gene makes stable cell line creation...
  6. Sequencing Primers

    Type
    Guide
    ...Forward Myc GCATCAATGCAGAAGCTGATCTCA Myc tag Forward Neo-F CGTTGGCTACCCGTGATATT 3' end of neomycin resistance...3' end of puromycin resistance gene Forward Puro-R GTGGGCTTGTACTCGGTCAT 5' end of puromycin resistance...gene Forward Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene Reverse NOS-F GCGTTCAAAAGTCGCCTAAG...
  7. Tetracycline Inducible Expression

    Type
    Collection
    ...inducible expression of mouse Oct4, Sox2, Klf4, and Myc for iPS cell generation Rudolf Jaenisch 51543 FUW-tetO-hOKMS...inducible expression of human Oct4, Sox2, Klf4, and Myc for iPS cell generation Tarjei Mikkelsen 172115 PB-TO-hNGN2...expression of shRNA with puromycin selection. See Plasmid #21916 for neomycin selection. TetR H1-2O2 Dmitri... with puromycin selection. See Plasmid #85973 for blasticidin and Plasmid #85972 for hygromycin selection...inducible expression; insert with Gateway cloning and puromycin selection rtTA-Advanced Tight TRE David Root 100521...blasticidin selection. See Plasmid #26730 for hygromycin selection. rtTA3 Eric Campeau 128061 pLVX-Tet3G...
  8. Zebrafish Plasmid Collection

    Type
    Collection
    ...either amino- or carboxyl-terminal tags, including Myc, HA, Flag, GST and eGFP epitopes. Zebrafish Tol2 ...
  9. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...while there are many types of epitope tags (eg. HA, MYC, Flag), they can be deleterious and cause aberrant...them to popularly used epitopes tags such as HA and MYC in vivo. The authors found that fusions to one particular...fragment with FKBP rapamycin binding domain of mTor (Cas9(N)-FRB-NES) resulting in a rapamycin-inducible Cas9...Addgene: Rapamycin-inducible Cas9 sets (Addgene plasmids 62883 &62884; 62885 & 62886) Rapamycin-inducible...separate reporter gene (EGFP, iRFP, IFP1.4, puromycin, neomycin or luciferase) to create a final lentiviral...Cas9 for genome editing. Without rapamycin treatment, the Cas9(N)-FRB-NES fragment is actively shuttled...to the nuclear export sequence. Treatment with rapamycin induces Cas9(N)-FRB-NES and Cas9(C)-FKBP-2xNLS...
  10. Bacterial Expression Systems

    Type
    Collection
    ... include: Epitope tags: 6xHis, Flag, Strep II, c-Myc, HA, V5, GST Solubility tags: MBP, SUMO, TrxA, Mocr...Lu 17972 pSE100 Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium tuberculosis Sabine...Ehrt 44561 pST-KT Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium tuberculosis Vinay...Acetamide Escherichia coli , Mycobacterium smegmatis Matthias Wilmanns 84692 pMyC-kan Acetamidase promoter... PnitA-NitR ε-caprolactam Escherichia coli , Streptomyces sp. Xuming Mao 46888 pMSP3545 PnisA Nisin Escherichia...promoter Acetamide Escherichia coli , Mycobacterium smegmatis Matthias Wilmanns 84689 pMyBADC-kan pBAD Arabinose...Arabinose Escherichia coli , Mycobacterium smegmatis Matthias Wilmanns 17806 pPro18 pPrpB Propionate Escherichia...
  11. Molecular Biology Reference

    Type
    Guide
    ...Acid Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL V5 GKPIPNPLLGLDST Xpress DLDDDDK or DLYDDDDK...Ethanol) 25 µg/mL Hygromycin B 200 mg/mL 200 µg/mL Kanamycin 50 mg/mL 50 µg/mL Spectinomycin 50 mg/mL 50 µg...
  12. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...deposited HA tagged BioID2 for N-terminal fusions and Myc tagged BioID2 for C-terminal fusions. Kim, et al...pharmaceutical industry, depend on the yeast, Saccharomyces cerevisiae, as a key host for the production...designed to complement unused auxotrophies in Saccharomyces strains by compensating for histidine (HIS3)...
Showing: 21 - 40 of 138 results