We narrowed to 40 results for: siae

...analysis of protein homomerization in Saccharomyces cerevisiae. Genome Res 29:135–145. https://doi.org/10.1101...

...the source organism for a gene insert. (e.g. S. cerevisiae) Plasmid Type: Choose an empty backbone if you...

... used across species, for example, in both S. cerevisiae and E. coli. Auxotrophic selection is especially...

...beyond Drosophila melanogaster or Saccharomyces cerevisiae (both fine research organisms) -  perhaps you...

...correlated with codon bias in both E. coli and S. cerevisiae. Protein folding - If a protein is encoded by...

...across all endogenous genes in E. coli and S. cerevisiae (Tuller et. al., 2010). Figure 1: An overview...

...red fluorescent protein tagging vectors for S. cerevisiae. PLoS One, 8 (7):e67902. https://doi.org/10.1371... fluorescent protein tagging in Saccharomyces cerevisiae. Yeast, 21 (8):661-70. https://doi.org/10.1002...selection markers for engineering in Saccharomyces cerevisiae. Microb Cell Fact, 12 :96. https://doi.org/10.1186...

... S. cerevisiae - Dueber Lab Yeast Prototrophy : Restoration of prototrophy in common S. cerevisiae lab...color. External Resources European Saccharomyces Cerevisiae Archive for Functional Analysis (EUROSCARF) (...

...Induced by Double-Strand Breaks in Saccharomyces cerevisiae. Paques F and Haber JE. Microbiology and Molecular...

...metabolic engineering applications in Saccharomyces cerevisiae.” FEMS Yeast Res. 12(2) (2012): 197-214. PubMed...

...protein‐tracking studies in the budding yeast Saccharomyces cerevisiae." Yeast 25.9 (2008): 651-659. PubMed PMID:18727145...

...pAB228v TrpRS S. cerevisiae Bacterial Ahmed Badran 209745 pAB228v6 TrpRS S. cerevisiae Bacterial Ahmed ...209746 pAMC070n1a12 ScTrpRS, Lum1PylRS, MmPylRS S. cerevisiae, Lum1, M. mazei Bacterial Ahmed Badran 212122...

... industry, depend on the yeast, Saccharomyces cerevisiae, as a key host for the production of their products...

...constructing highly-tunable GPCR-based biosensors in S. cerevisiae cpFRET Kit includes plasmids to construct custom...characterize the intracellular environment of S. cerevisiae MOSAIC Kit includes 35 plasmids expressing a ...

...Kit Rinehart Recombinant Phosphoprotein Kit S. cerevisiae Advanced Gateway Destination Vectors TAL Effectors...

... derived from P1 E. coli bacteriophage and S. cerevisiae , respectively. Other tyrosine recombinases include...

...bacteria ( E. coli, B. subtilis ), yeast ( S. cerevisiae ), worm ( C. elegans ), fruit fly, zebrafish,...

...Plants (monocots and dicots) C. elegans Yeast ( S. cerevisiae and S. pombe ) Zebrafish Xenopus References Barrangou...

...assembly of single and multi-gene constructs for S. cerevisiae expression. Multiplex Yeast Toolkit (MYT) Yeast...MoClo-YTK (Dueber) for genetic engineering of S. cerevisiae , enabling larger multi-gene constructs, multiplexed...transcription units for protein secretion in yeasts S. cerevisiae and P. pastoris (a.k.a. K. phaffii ). POMBOX ...the GoldenBraid system, for integration in S. cerevisiae . Easy-MISE Toolkit Yeast Expression Paola Branduardi...improved heterologous protein production in S. cerevisiae . MoClo Baculo Toolkit Yeast Expression, Insect...expression vectors for expression in baculovirus or S. cerevisiae . Compatible with MoClo-YTK , Bac-to-Bac, and...

...AATATACCTCTATACTTTAACGTC S. cerevisiae GAL1 promoter Forward Gal10pro-F GGTGGTAATGCCATGTAATATG S. cerevisiae GAL10 promoter... Reverse GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter Forward GW-3' GCATGATGACCACCGATATG...