...analysis of protein homomerization in Saccharomyces cerevisiae. Genome Res 29:135–145. https://doi.org/10.1101...

...the source organism for a gene insert. (e.g. S. cerevisiae) Plasmid Type: Choose an empty backbone if you...

...beyond Drosophila melanogaster or Saccharomyces cerevisiae (both fine research organisms) -  perhaps you...

...correlated with codon bias in both E. coli and S. cerevisiae. Protein folding - If a protein is encoded by...

...across all endogenous genes in E. coli and S. cerevisiae (Tuller et. al., 2010). Figure 1: An overview...

...red fluorescent protein tagging vectors for S. cerevisiae. PLoS One. 2013 Jul 2;8(7):e67902. doi: 10.1371... fluorescent protein tagging in Saccharomyces cerevisiae. Yeast. 2004 Jun;21(8):661-70. doi: 10.1002/yea...selection markers for engineering in Saccharomyces cerevisiae. Microb Cell Fact. 2013 Oct 25;12:96. doi: 10.1186...

...Induced by Double-Strand Breaks in Saccharomyces cerevisiae. Paques F and Haber JE. Microbiology and Molecular...

... S. cerevisiae - Dueber Lab Yeast Prototrophy : Restoration of prototrophy in common S. cerevisiae lab...color. External Resources European Saccharomyces Cerevisiae Archive for Functional Analysis (EUROSCARF) (...

...metabolic engineering applications in Saccharomyces cerevisiae.” FEMS Yeast Res. 12(2) (2012): 197-214. PubMed...

...protein‐tracking studies in the budding yeast Saccharomyces cerevisiae." Yeast 25.9 (2008): 651-659. PubMed PMID:18727145...

...pAB228v TrpRS S. cerevisiae Bacterial Ahmed Badran 209745 pAB228v6 TrpRS S. cerevisiae Bacterial Ahmed ...209746 pAMC070n1a12 ScTrpRS, Lum1PylRS, MmPylRS S. cerevisiae, Lum1, M. mazei Bacterial Ahmed Badran 212125...

...GAL1 AATATACCTCTATACTTTAACGTC (Invitrogen) S. cerevisiae GAL1 promoter, forward primer Gal10pro-F GGTGGTAATGCCATGTAATATG...GGTGGTAATGCCATGTAATATG (Stratagene) S. cerevisiae GAL10 promoter, forward primer Gal4 N-term GAGTAGTAACAAAGGTCAA...reverse primer GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter, forward primer GW-3' GCATGATGACCACCGATATG...

... industry, depend on the yeast, Saccharomyces cerevisiae, as a key host for the production of their products...

...Kit Rinehart Recombinant Phosphoprotein Kit S. cerevisiae Advanced Gateway Destination Vectors TAL Effectors...

...49014 pRPR1_gRNA_ handle_RPR1t pRPR1 HindIII S. cerevisiae LEU2 none, need Cas9 plasmid Lu Do you have suggestions...

...bacteria ( E. coli, B. subtilis ), yeast ( S. cerevisiae ), worm ( C. elegans ), fruit fly, zebrafish,...

...Plants (monocots and dicots) C. elegans Yeast ( S. cerevisiae and S. pombe ) Zebrafish Xenopus References Barrangou...

...Knockout Human Doench 3rd 2 40,964 Ingolia lab S cerevisiae CRISPRi v1 – barcodes 181005 161769 Inhibition...

...characterize the intracellular environment of S. cerevisiae . The MOSAIC Kit from the Cohen laboratory includes...