Skip to main content

We narrowed to 41 results for: siae

Showing: 21 - 40 of 41 results
  1. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ... vectors - PCR-based C-terminal tagging in S. cerevisiae pCS2FLAG - N- or C-terminal 2xFLAG...of proteins on the extracellular surface of S. cerevisiae cells His-tagged versions of pFastBac LIC vectors...Plasmids page pBF3060 - Metabolic engineering in S. cerevisiae TALENs Gene targeting TALEN kits - Construct ... and expression of bacterial gene clusters S. cerevisiae plasmids for multiple marker selection TRP1 Yeast...
  2. Plasmids 101: Codon usage bias

    Type
    Blog Post
    ...correlated with codon bias in both E. coli and S. cerevisiae. Protein folding - If a protein is encoded by...
  3. Plasmids 101: Shuttle Vectors

    Type
    Blog Post
    ... used across species, for example, in both S. cerevisiae and E. coli. Auxotrophic selection is especially...
  4. Botman-Teusink Yeast FP Collection

    Type
    Collection
    ...red fluorescent protein tagging vectors for S. cerevisiae. PLoS One, 8 (7):e67902. https://doi.org/10.1371... fluorescent protein tagging in Saccharomyces cerevisiae. Yeast, 21 (8):661-70. https://doi.org/10.1002...selection markers for engineering in Saccharomyces cerevisiae. Microb Cell Fact, 12 :96. https://doi.org/10.1186...
  5. Microbiology Resources

    Type
    Collection
    ... S. cerevisiae - Dueber Lab Yeast Prototrophy : Restoration of prototrophy in common S. cerevisiae lab...color. External Resources European Saccharomyces Cerevisiae Archive for Functional Analysis (EUROSCARF) (...
  6. Genetic Code Expansion

    Type
    Collection
    ...pAB228v TrpRS S. cerevisiae Bacterial Ahmed Badran 209745 pAB228v6 TrpRS S. cerevisiae Bacterial Ahmed ...209746 pAMC070n1a12 ScTrpRS, Lum1PylRS, MmPylRS S. cerevisiae, Lum1, M. mazei Bacterial Ahmed Badran 212122...
  7. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ... industry, depend on the yeast, Saccharomyces cerevisiae, as a key host for the production of their products...
  8. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...constructing highly-tunable GPCR-based biosensors in S. cerevisiae cpFRET Kit includes plasmids to construct custom...characterize the intracellular environment of S. cerevisiae MOSAIC Kit includes 35 plasmids expressing a ...
  9. Synthetic Biology - Overview

    Type
    Collection
    ...Kit Rinehart Recombinant Phosphoprotein Kit S. cerevisiae Advanced Gateway Destination Vectors TAL Effectors...
  10. Modular Cloning Guide

    Type
    Guide
    ...assembly of single and multi-gene constructs for S. cerevisiae expression. Multiplex Yeast Toolkit (MYT) Yeast...MoClo-YTK (Dueber) for genetic engineering of S. cerevisiae , enabling larger multi-gene constructs, multiplexed...transcription units for protein secretion in yeasts S. cerevisiae and P. pastoris (a.k.a. K. phaffii ). POMBOX ...the GoldenBraid system, for integration in S. cerevisiae . Easy-MISE Toolkit Yeast Expression Paola Branduardi...improved heterologous protein production in S. cerevisiae . MoClo Baculo Toolkit Yeast Expression, Insect...expression vectors for expression in baculovirus or S. cerevisiae . Compatible with MoClo-YTK , Bac-to-Bac, and...
  11. Sequencing Primers

    Type
    Guide
    ...AATATACCTCTATACTTTAACGTC S. cerevisiae GAL1 promoter Forward Gal10pro-F GGTGGTAATGCCATGTAATATG S. cerevisiae GAL10 promoter... Reverse GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter Forward GW-3' GCATGATGACCACCGATATG...
Showing: 21 - 40 of 41 results