We narrowed to 39 results for: tetracycline
-
TypeBlog Post...Using the Tet-on system, his lab has created a tetracycline cas9 inducible knock-out system. His lab is ...
-
Retrovirus Plasmids
TypeCollection...William Hahn 63704 pRetroX GFP T2A Cre CMV/MSV Tetracycline inducible expression of GFP T2A Cre fusion in... -
Hot Plasmids and Viral Preps - May 2021
TypeBlog Post...where gRNA expression is induced by anhydrous tetracycline. Three new anti-CRISPRs were identified that... -
Bacterial Expression Systems
TypeCollection...Controlled Expression Resources Check out our Tetracycline (Tet) Inducible Expression Collection for an...an extensive selection of plasmids using tetracycline-regulated transcriptional activation or repression... -
Protocol - How to Inoculate a Bacterial Culture
TypeProtocol...mL Kanamycin 50 µg/mL Spectinomycin 50 µg/mL Tetracycline 10 µg/mL Tips and FAQ What is the difference... -
Hot Plasmids: Fall 2024
TypeBlog Post...with Cas9 on an integrative plasmid containing tetracycline repressor TetR and resistance selection marker... -
Easi-CRISPR: Generating Knock-In and Conditional Mouse Models
TypeBlog Post...mCherry etc.), recombinases (Cre, Flp etc.), and tetracycline drug induction systems (ttA or rtTA) are between... -
Mycoplasma Contamination: Where Does It Come From and How to Prevent It
TypeBlog Post...fluoroquinolone ciprofloxacin, ciprobay, zagam, baytril, tetracycline, etc. are available for mycoplasma removal from... -
Lentivirus Plasmids
TypeCollection...Sheltzer 20342 FUW-M2rtTA 3rd Contains reverse tetracycline transactivator. Rudolf Jaenisch 131626 pHAGE-mt-mKeima... -
Viral Vectors 101: AAV Variables That Matter
TypeBlog Post...2002). Lack of an Immune Response against the Tetracycline-Dependent Transactivator Correlates with Long-Term... -
Lambda Red: A Homologous Recombination-based Technique for Genetic Engineering
TypeBlog Post... a lambda red phage, λTetR, that carries the tetracycline resistance gene and the lambda red repressor... -
Cre-Lox and Other Site-Specific Recombinases
TypeCollection...only activated in the presence of tamoxifen. A tetracycline-regulated or other drug-inducible approach may... -
Pouring LB Agar Plates
TypeProtocol.../mL 50 µg/mL Spectinomycin 50 mg/mL 50 µg/mL Tetracycline 10 mg/mL 10 µg/mL Notes: Unless otherwise indicated... -
Promoters
TypeGuide...elongation factor promoter TRE Inducible Multiple Tetracycline response element promoter; often optimized for...such as shRNAs and gRNAs. Additional Resources Tetracycline (Tet) Inducible Expression Plasmids 101: The... -
CRISPR Methods for Bacteria: Genome Engineering, CRISPRa, CRISPRi, Base Editing, and More
TypeBlog Post...presence of the inducer, in this case anhydro-tetracycline (aTc). By cloning in two tandem copies of the... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...Find more Tet-inducible empty backbones on our Tetracycline (Tet) Inducible Expression page Bacteria Lac... -
Sequencing Primers
TypeGuide...Reverse Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene Reverse TK-pA-R TTGTCTCCTTCCGTGTTTCA... -
Molecular Biology Reference
TypeGuide.../mL 50 µg/mL Spectinomycin 50 mg/mL 50 µg/mL Tetracycline 10 mg/mL 10 µg/mL *Carbenicillin can be used... -
27 Hot Plasmids from 2016
TypeBlog Post...unique tissue-specific promoters expressing GFP, tetracycline response elements, and shRNAs many of which ...