We narrowed to 383 results for: Lor
-
TypeGuide...primer CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene, reverse primer CMV Forward...
-
Adenovirus Guide
TypeGuide... (Link opens in a new window) Mendonça, S. A., Lorincz, R., Boucher, P., & Curiel, D. T. (2021). Adenoviral... -
Adeno-associated virus (AAV) Guide
TypeGuide...short coding sequences of channelrhodopsins, halorhodopsins, and other optogenetic genes makes them suitable...