Skip to main content

We narrowed to 396 results for: Lor

Showing: 381 - 396 of 396 results
  1. Optogenetics Guide

    Type
    Guide
    ...Guillardia theta ). Halorhodopsins Halorhodopsins are light-gated, inward-directed chloride pumps isolated ...types. Check out our blog for practical tips , explore Addgene's Optogenetics Plasmid Collection , or ...depression, drug addiction, and more. Next, let's explore some commonly used microbial opsins, including ... ChRs from other species include CoChR (from Chloromonas oogama ) and SdChR (from Scherffelia dubia )....identified in other species. By acting as light-gated chloride channels, these variants result in the hyperpolarization...isolated from halobacteria. Wild-type halorhodopsin, known as NpHR (from Natronomonas pharaoni ), causes hyperpolarization...Archaerhodopsins Archaerhodopsin-3 (Arch) from Halorubrum sodomense and its variants are commonly used ...
  2. Antibody Guide

    Type
    Guide
    ... Here, HRP is used as a colorimetric, in which the reaction produces a colored product that accumulates...well. In colorimetric assays, protein amount can be determined by correlating the amount of color in a well...small multiplex experiments 4-color flow panel: BV421, FITC, PE, and APC 4-color microscopy panel: DAPI for...molecules , proteins that emit a measurable light or color in response to a specific stimulus, can be conjugated...than HRP, fluorophores are available in a range of colors activated by different wavelengths, allowing for...indirect or direct method. Since IF uses fluorophore color to differentiate between the targets of interest...theoretically allow for roughly fifty different fluorophore colors in flow cytometry, but the largest panels used ...
  3. Chemogenetics Guide

    Type
    Guide
    ...Compound 21, deschloroclozapine (DCZ), perlapine, and olanzapine, have all been explored as alternative... population. Read this guide to learn more, or explore Addgene's Chemogenetics Plasmid Collection . Figure...pair a PSAM domain with a Glycine-receptor (GlyR) chloride-selective IPD. Binding of the cognate PSEM allows...Kumata, K., Seki, C., … Minamimoto, T. (2020). Deschloroclozapine, a potent and selective chemogenetic actuator...25002280 Strader, C. D., Gaffney, T., Sugg, E. E., Candelore, M. R., Keys, R., Patchett, A. A., & Dixon, R....
  4. CRISPR Guide

    Type
    Guide
    ...fluorescently-tagged RNA-binding proteins (RBPs). Multicolor CRISPR imaging can be achieved by using orthogonal... L., Jung, K., McCool, R. S., Johnson, K. A., & Taylor, D. W. (2022). Structural basis for mismatch surveillance...Petris, G., Montagna, C., Reginato, G., Maule, G., Lorenzin, F., Prandi, D., Romanel, A., Demichelis, F., ...Zhang, H., Finkelstein, I. J., Johnson, K. A., & Taylor, D. W. (2024). Unraveling the mechanisms of PAMless...Wolfe, S. A., Zhang, S., & Pederson, T. (2015). Multicolor CRISPR labeling of chromosomal loci in human ...., Ramos, D., Hibshman, G. N., Wright, J. T., & Taylor, D. W. (2023). Structural snapshots of R-loop formation...
  5. Molecular Biology Reference

    Type
    Guide
    ...100 µg/mL Carbenicillin* 100 mg/mL 100 µg/mL Chloramphenicol 25 mg/mL (dissolve in Ethanol) 25 µg/mL Hygromycin...bases and a microscope captures the fluorescent color that is emitted each time a base is added. Again... base (A,C,T, or G) is labeled with a different color, making it easy to identify the order of the DNA...
  6. Sequencing Primers

    Type
    Guide
    ...sequencing primer" and "3' sequencing primer" or explore the sequence map in SnapGene or other software ...Reverse CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG...
  7. Modular Cloning Guide

    Type
    Guide
    ...Modular Cloning Chloroplast Toolbox Plant Expression Scott Lenaghan 122 plasmids with chloroplast-specific genetic...
  8. Guide to Using Pooled Libraries

    Type
    Guide
    ...eukaryotic proteins, such as antibodies. Advantages Explore vast sequence diversity Can map epitopes or binding...
  9. Adenovirus Guide

    Type
    Guide
    ... (Link opens in a new window) Mendonça, S. A., Lorincz, R., Boucher, P., & Curiel, D. T. (2021). Adenoviral...
Showing: 381 - 396 of 396 results