Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 716 results for: cas

Showing: 421 - 440 of 716 results

  1. Mesothelioma - Causes, Symptoms, and Treatment

    Type
    Blog Post
    ...approach known as multimodal therapy. Sadly, in many cases the cancer is diagnosed so late that these treatments...success in treating mesothelioma, such as in the case of Paul Zygielbaum. A different approach to immunotherapy...and used throughout the world. New mesothelioma cases could be greatly decreased through a ban on asbestos...

  2. Data Freedom: The Expansion of Data Sharing in Research Publications

    Type
    Blog Post
    ...their data months or years before others. In some cases, typically consortia involving genomic screens, ...the originating researchers, even if they are occasionally beaten to press, as there is so much analysis...track the motion of multiple animals on different occasions via video, generating huge amounts of data. When...

  3. Sequencing Primers

    Type
    Guide
    ... of Gateway cassette, forward primer GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette, reverse primer...beta-globin intron, for pCAG plasmids, forward primer pCasper-F GGGTTTTATTAACTTACAT (Vosshall lab) 5' end of ...of Drosophila mini-white gene, reverse primer pCasper-hs GCAACTACTGAAATCTGCCAAG Drosophila Hsp70 promoter...TCCTTTCCAGCGAGGTTCTA Murine leukemia virus (MuLV), reverse primer RCAS-F ACATGGGTGGTGGTATAGCGCTTGCG (Orsulic lab) 3' of...

  4. Four Ways to Package Transgenes That Exceed the Size Limit of Adeno-associated Virus

    Type
    Blog Post
    ...complement each other to restore the full-expression cassette. AAV’s natural ability to reassemble fragmented...sequential homology directed repairs (HDR) with CRISPR/Cas9. Donor A contains: 400bp homology arms to the site...2017) CRISPR-Mediated Integration of Large Gene Cassettes Using AAV Donor Vectors. Cell Reports 20:750–756...

  5. Antibodies 101: Introduction to Immunofluorescence

    Type
    Blog Post
    ... an intact sample, a cell in the case of ICC or a tissue in the case of IHC. IF is used specifically when...interest within an intact cell, tissue, or, in some cases, a whole organism. But, as with any antibody-based...

  6. Plasmids 101: Expressing shRNAs for RNA Interference

    Type
    Blog Post
    ...in lentiviral or retroviral backbones. On some occasions, shRNAs are transiently expressed using either...promoters with no tissue specificity, so in some cases they can lead to toxicity and off target effects... an Old Favorite CRISPR 101: Targeting RNA with Cas13a (C2c2) Plasmids 101: The Promoter Region – Let'...

  7. Antibodies 101: Multiplex Immunofluorescence

    Type
    Blog Post
    ...(Mouse IgG2a) Goat anti-mouse IgG2a CASPR anti-CASPR mAb K65/35 (Mouse IgG1) Goat anti-mouse...Neocortex labeled with anti-pan-Nav (magenta), anti-CASPR (green), and anti-Kv2.1 (cyan). (B) Cerebellum labeled...

  8. Plasmids 101: Dimers and Multimers

    Type
    Blog Post
    ...plasmid with repeating sequences. In some specific cases, multimerization has been observed to occur more...reduce the frequency of multimerization, and in some cases completely prevent the formation of plasmid multimers...Sharratt, 1984; Summers et al., 1993). In these cases, screening multiple bacterial colonies using one...

  9. Transferable Skills Guide: Teamwork

    Type
    Blog Post
    ...environmentally friendly organization on the planet, in which case whoa! Mission accomplished! One example of a mission-based... a little bit about everything or in Jefferson’s case, even a lot about everything. Fast forward a few...received 104 million results (Here’s the top one, in case you’re interested). “But I’m an introvert!” is not...

  10. Antibodies 101: Flow Cytometry

    Type
    Blog Post
    ...can alter the structure of the protein. In some cases this can lead to changes or a complete loss of protein...lipids including those of the cell membrane. In some cases, this can mask epitopes such that immune complexes...only enter cells with disrupted membranes as is the case with dead or dying cells. DNA binding dyes are not...

  11. Guide to Using Pooled Libraries

    Type
    Guide
    ...the plasmids to the cells of interest. In either case, next-generation sequencing of the maxiprep DNA ... Most cells die or do not pass selection (in the case of a reporter) Sort “winning” cells Sequence those...information on genome-wide screening with CRISPR/Cas9 . Browse our Viral Vector resources . Check out ...popular libraries! Genome-wide Screening Using CRISPR/Cas9 Lentiviral CRISPR Libraries Enable Genome-Scale,...

  14. Lentiviral Vector Guide

    Type
    Guide
    ...consideration for oncogenes should be made on a case-by-case basis. As with most experiments, infection risks...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain..., J. G., & Zhang, F. (2013). Genome-Scale CRISPR-CAS9 knockout screening in human cells. Science , 343...

  15. Using AAV for Neuronal Tracing

    Type
    Blog Post
    ..., and bidirectional transport for AAV1, -8, -9 (Castle et al., 2014). Differences between AAV serotypes...space along an axon, this does not seem to be the case for either AAV1 or AAV9. It should be noted that...PMID: 25555356. PubMed Central PMCID: PMC4324159. Castle, M.J., Gershenson, Z.T., Giles, A.R., Holzbaur,...

  16. The Twelve Days of CRISPR

    Type
    Blog Post
    ...of CRISPR, Addgene gave to me: RNA editing with Cas13.  On the tenth day of CRISPR, Addgene gave to me...to me: methods for adenoviral delivery of CRISPR/Cas9.  On the twelfth day of CRISPR, Addgene gave to ...

  18. Antibody Guide

    Type
    Guide
    ...expression. Monoclonal antibodies are necessary in cases where extreme specificity is important. Their epitope...when epitope specificity is not a concern or in cases where you may want to identify or collect the protein...azide, as it acts as an inhibitor to HRP. In those cases, thimerosal can be used as an antimicrobial agent... using the above process and try again. In some cases, it may be preferable to buy small aliquots of many...

  19. Editor's Choice, October 2016

    Type
    Blog Post
    ...Community.” This post leads readers to our latest podcast all about graduate student life and how establishing...Community Engineering the Plant Genome Using CRISPR/Cas9 Healthcare Consulting: A Door to the Business of...

  20. Grad School Advice Part 1: Picking a Lab and a Project

    Type
    Blog Post
    ...and a project. Listen to the interview here! Podcast Breakdown (Time : Topic) 0:00 - 0:28 : Niroshi ...the audio engineer and producer for the Addgene Podcast.     Additional Resources on the Addgene Blog ...
Showing: 421 - 440 of 716 results