We narrowed to 747 results for: cat.1

...template including the desired edit. Figure 1: Prime Editing schematic. Created with BioRender.com...BioRender.com. The pegRNA specifies both the genomic location to be edited and the sequence of the edit, so ...its design changes for every new prime editing application. And optimizing its sequence is important, as...left), while pegRNAs that use other bases in this location bind to Cas9 with canonical sgRNA structure (right...structured motifs like mpknot, use the pegRNA Linker Identification Tool (pegLIT) to create linkers that minimize...

... reached labs in over 75 countries. Figure 1: SARS-CoV-2 proteins and other components. Image from...a method that uses loop-mediated isothermal amplification after reverse transcription (RT-LAMP) and a ...receptor for SARS-CoV. The lab also found that cathepsins play a role in SARS-CoV infection and deposited...deposited plasmids for the expression of cathepsin S, L, and B. This became a great starting point for SARS-CoV..., Zengel JR, Sathyan V, Nguyenla X, Van Dis E, Catamura C, Yamashiro LH,  Begeman A, Stark JC, Shon DJ...

... end sequences (R and L ends).  Figure 1: (A) Components involved in each type of CRISPR-Transposon... and have been adapted for a wide variety of applications - as mutagenesis tools for genetic studies (... The process also creates a 5-bp target-site duplication (TSD), a hallmark characteristic of the Tn7-family...the new streamlined VchINT system was shown to catalyze insertion of mini-transposons up to 10 kb in size...at one or multiple desired genomic loci. Many applications of these systems have already been demonstrated...

...blood test for HMGB1, the high mobility group box 1 protein. Normally localized to the nucleus, if the...cancer. These later stages of a cancer diagnosis indicate, for Stage 3, that the cancer is large in size...size and may have spread while Stage 4 indicates that the cancer has spread from where it originated to ... dire prognosis for mesothelioma patients is to catch the disease earlier. New techniques are currently... working to fight the cancer.  Beyond early modifications to standard treatments and early detection, ...

...testing. You can find Nick on LinkedIn. References 1. Skloot, Rebecca, and Bahni Turpin. The immortal life...Marker-independent identification of glioma-initiating cells. The International Cell Line Authentication Committee...propagation of the line, and can include assays for authentication and contamination) and cell lines can become...let alone the human cost. Here are just a few publications which have since been retracted due to cell ...

...mammalian expression from human elongation factor 1 alpha Constitutive  Tends to give consistent expression...resistance gene and the origin of replication are necessary to replicate plasmids and make sure the cells...length version is strong with high expression. Truncated promoters are constitutive with lower expression...metabolic operon Inducible by arabinose and repressed catabolite repression in the presence of glucose or by competitive...

...antibiotic selection. Essentially, this gene is a 2-in-1 providing both bacterial and eukaryotic selection,...common antibiotic resistance genes and which applications are best (or worst) for each antibiotic. The...is expensive (relative to amp), and for some applications, the benefit it offers is marginal. Fortunately...antibiotic resistance ultimately comes down to your applications and needs. The more niche and specific your ...

...such as model systems and primary cells. References 1. Doench, John G., et al. "Rational design of highly...is only effective when sgRNAs target a specific location on the gene. For CRISPRa, sgRNAs were targeted...Calabrese pooled library and lentiviral prep here! Applications for the Root and Doench CRISPR libraries Overall...et al. "A protein-tagging system for signal amplification in gene expression and fluorescence imaging....

...fun together! Laura’s Top 10 Event Planning Tips! 1. Take suggestions Some of Addgene’s best events have...be an obvious one, but don’t make things too complicated for yourself (especially if you are the sole ...sole event planner)! If you have a very intricate itinerary, there is a higher likelihood that something ...Delegate- it will save you time and sanity!    10. Communicate Make sure people know that there is something...

...drives our bioinformatics needs       Fig. 1: QC'ing data at Addgene is like standing under a Niagara... from depositing laboratories and associated publications, but our quality control (QC) standards have...such as 96-well microplates, and thanks to our dedicated product and development teams, frequent updates...can be easily shared with others without any complicated setup. We created, tested, and debugged each ...

... of low-toxicity RNA editing tools.   Fig. 1 Schematic of luciferase RNA knockdown assays using...experimental design and its potential for clinical applications. Specifically, efficacy rates of Cas7-11 were...place, while increasing the number of potential applications. But they weren’t done engineering quite yet... at the bench and potentially in therapeutic applications. The potential of CRISPR has yet to fully taken...

... done and we’re onto the next story. Figure 1: Addgene’s Agile Approach Sharing is caring There...diverse group of ethnicities, cultures, genders, educational, and professional backgrounds. Sometimes this... information. It is quite possible that the clarifications lead to the story being scrapped or broken ...While writing the code, we may need additional clarification and again we collaborate with the Product Team...

...inclusion bodies and is folding properly. References 1. Angov, Evelina, et al. "Heterologous protein expression...ribosome may therefore stall at inappropriate locations or fail to make it through the entire transcript...generally segregate with the cell pellet during purification procedures. Even if you produce a large amount...

...commandments for making it all work – most of the time. #1 Thou shalt find enjoyment in your work If you are ...other activities. Take care of yourself. Take a vacation alone with your partner – no kids. Get a massage...

...indel formation and phenotypic changes as early as 1 week post-injection. Livers from these mice were histologically...described above showed successful target modification, indicating that AAV is a good delivery vehicle for... with AAV. This system fuses catalytically dead dCas13b to the catalytic domain of RNA deaminase ADAR2...overall packaging capacity but necessitating purification and co-infection of two AAVs. Cas9 orthologs...Streptococcus thermophilus and a rationally-designed truncated Cas9. Unfortunately, certain drawbacks limit the...that limits the number of targetable loci, and truncated Cas9 has much lower efficiency than its wild-type...the AAV-SaCas9-sgRNA constructs mediate genome modification, but they did so without a substantial immune...

...email Ryan at [email protected]   References 1. Larivière, Vincent, Yves Gingras, and Éric Archambault...be part of the answer. Problems with written publications Online tools like ResearchGate, GoogleScholar... that the big breakthroughs in my discipline, education, will come from ideas garnered from research in...from the science of others. Improving science communication through video     Video abstracts about research... to be that video is the future in terms of communicating ideas. In 2012, for example, 3 billion hours...scientific videos were for entertainment or basic education (i.e., learn why water freezes) there was a growing...video usurps the written word as the means for communicating research. Short videos of 3 to 5 minutes provide...

...yourself in a creative rut, read on!   Fig 1: Blugene using creative problem-solving in the lab...resources you’ll need ahead of time and mute your notifications during. (Boyes, 2019) If you’ve taken the time... particularly relevant to you. Elect a devil’s advocate. This is the person whose job it is to disagree...think about alternative options. When a devil’s advocate is elected, others may feel they can share opposing...dissenting opinions or ideas. While the best devil’s advocate is one who truly disagrees with the group (because...adamantly for their solution), selecting a devil’s advocate is a good option for any meeting in which the ...other way,” you probably have reason to continue advocating for your idea. Our product team has implemented...

...to an antigen. AdEasier-1 cells BJ5183 E. coli cells containing the pAdEasy-1 packaging plasmid. Adenovirus...icosahedral capsids and build new virions. Figure 1: Wild-type adenovirus and its genome. Genes over or... This construct is then transformed into AdEasier-1 cells (Addgene #16399) , which are BJ5183 E. coli ... viruses. The adenoviral backbone plasmid pAdEasy-1 (Addgene #16400) is suitable for most purposes. For...production system. Figure is based on the use of pAdEasy-1. Created with BioRender.com. AdMax™ AdMax™ is another...landscape . Signal Transduction and Targeted Therapy, 6 (1), 53. https://doi.org/10.1038/s41392-021-00487-6 (...as a Zika virus vaccine . Scientific Reports, 10 (1), 3613. https://doi.org/10.1038/s41598-020-60238-5...

... over again. Here’s that process!   Figure 1: The Design-Build-Test-Learn cycle adapted for video...Creating great educational science videos is tough. Is the content accurate? Are we conveying complex... had set up involved multiple people in tight locations. Conference rooms for on-screen presenters! Labs...wasn’t going to work for the majority of our educational videos. In addition, it’s really asking a lot...receiver, to beam the camera’s image to my remote location, live. After doing a bit of looking, I found an...

...therapies to clinical trials in 2021. Figure 1: Schematic of the human MECP2 locus and MECP2 protein...detrimental as too little, resulting in MECP2 duplication syndrome or Rett Syndrome, respectively. One ...Efficient and Precise CRISPR/Cas9-Mediated MECP2 Modifications in Human-Induced Pluripotent Stem Cells. Front..., Hector RD, Cobb SR, Bird A (2017) Radically truncated MeCP2 rescues Rett syndrome-like neurological ...

...complex. So how exactly does this work? Figure 1: APOBEC- and Cas9-mediated editing (ACE) reporter ...2019). TREE is a real-time, fluorescent based identification system for the isolation of base-edited cell...to BFP Conversion: A Versatile Assay for the Quantification of CRISPR/Cas9-mediated Genome Editing. Molecular...Harris RS (2018) A fluorescent reporter for quantification and enrichment of DNA editing by APOBEC–Cas9...

...collaborations, keep these jobs in mind! References 1. Sinche, Melanie, et al. "An evidence-based evaluation...hesitation to ‘approach strangers’ and learn how to communicate outside my scientific expertise. Organizing a...will lead! Read our blog post about fostering communication in remote collaborations! Stay in touch: Maintaining...connection is to make sure you keep open lines of communication with colleagues who move on to new organizations...

...Addgene's Chemogenetics Plasmid Collection . Figure 1: General overview of a chemogenetics experiment. Early...bidirectional control of neuronal activity. Table 1: Descriptions of DREADDs and their activity in neurons... while PSAMs and LMOs have an effect for only 0.5–1 hours after delivery. Chemogenetic Ligand The chemogenetic...Causal Cellular and Neuronal Biology. Physiol Rev, 98 (1), 391–418. https://doi.org/10.1152/physrev.00009.2017...Neurophotonics 11 (2), 021005. https://doi.org/10.1117/1.NPh.11.2.021005 PMID: 38450294 Coward, P., Wada, H... Gi-coupled receptor. Proc Natl Acad Sci USA, 95 (1), 352–357. https://doi.org/10.1073/pnas.95.1.352 PMID... 451–460. https://doi.org/10.1007/s00213-004-2017-1 PMID: 15765260 Farrell, M. S., Pei, Y., Wan, Y., Yadav...

...typically ranges from 8–10 kb, encoded on RNA (Figure 1). This RNA is reverse transcribed into the provirus...been removed or mutated for increased safety. Figure 1: Wild-type lentivirus genome. Created with BioRender.com...genes (for example, vif , vpr , vpu , and nef for HIV-1). The LTRs flank all of these genes, and anything ...transgene and LTRs (chimeric 5’ LTR) Packaging plasmid 1 — contains gag and pol Packaging plasmid 2 — contains...and third-generation systems, please refer to Table 1. Figure 4: Third-generation lentiviral plasmids. Created...heterologous enhancer/promoter such as CMV or RSV Table 1. Summary of key differences between second- and third-generation...More Lentiviral Vector topics Addgene Protocols pLKO.1 - TRC Cloning Vector Protocols Lentiviral Vector Production...

...conference for any reason was a Singleton. Figure 1: The Binning Singletons logo. Image: James et al.,... written up in mSphere. A post-meeting survey indicated that the program was largely a success, but also...

...and biotin plasmids at Addgene!     Figure 1: Indirect detection of target markers can be achieved...labeling can be subdivided into two categories, depending on the location of the targeted markers. Some commercially...proteins, such as receptors, or post-translational modifications on those proteins, like glycosylation patterns...Depending on the research question and downstream application, one or several of those techniques can be used...your flow analysis. However, certain downstream applications, like an in vivo adoptive transfer of those ...labeling Oftentimes, a marker of interest is not located on the cell membrane but inside the cell. Due to...but preserving the cellular state (think of mummification). Permeabilization, as the name suggests, perforates...

...’re not one of these people yourself.  Fig 1: Quote from Michael Ende, courtesy of morefamousquotes.com...conflict is not always what was communicated but how it was communicated. The next step is to come up with...of lapsed communication. Making some assumptions about how something should be communicated is necessary...skill in and of itself. Conflict can also be categorized as either “personal” or “substantive”. A personality-based...traced back to one of a few trouble spots:  Communication (or lack thereof): Information sharing gets ...organization gets, and creating new avenues of communication can create as many problems as it can solve....meeting? Different teams frequently prefer to communicate in different ways, so the source of the conflict...

...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward M13 Forward...TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region Reverse CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol ...LacZ Reverse LexA CGTCAGCAGAGCTTCACCATTG 3' end of LexA DNA binding domain Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT... GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter... plasmid verification, Addgene has used a number of primers for Sanger sequence verification over the ... AC5 ACACAAAGCCGCTCCATCAG Drosophila Actin 5C promoer Forward Alpha-factor TACTATTGCCAGCATTGCTGC Alpha...Bglob-intron-F CTGGTCATCATCCTGCCTTT Rabbit beta-globin intron Forward Bglob-intron-R TTTGCCCCCTCCATATAACA Rabbit...

...gene, and a terminator, as in Figure 1). Next, up to six Level 1 modules can be assembled into a Level...consists of three sets of cloning vectors (Level 0, 1, and 2) which can be used in successive assembly steps... 0 parts are directionally assembled into a Level 1 vector creating a single transcriptional unit (for...maintain the final plasmid after transformation. Figure 1: Overview of the MoClo Toolkit components and assembly...protein purification tags and fluorescence proteins for use in E. coli for a variety of applications. EcoFlex...Modular Cloning Blog: Plasmids 101 Modular Cloning Applications and Kits Blog: Plasmids 101 Golden Gate Cloning... between. MoClo can be used for a variety of applications—like building synthetic genetic circuits, engineering...

...editing efficiency and fidelity. Nature Communications , 13 (1), 1425. PMID: 35301321 Edraki, A., Mir,... DNA interrogation by SpRY-Cas9. Nature Communications , 15 (1), 3663. PMID: 38688943 Hsu, P. D., Scott...CRISPR-Cas9 to increase its specificity. Nature Communications , 9 (1). PMID: 30082838 Maddalo, D., Manchado, ...with an engineered chimeric Cas9. Nature Communications , 14 (1), 6175. PMID: 37794046 Small precision ...integration by homology-dependent repair. Nature Communications . 9 (1), 1133. PMID: 29556040 Chen, P. J., Hussmann...transcriptional reprogramming in bacteria. Nature Communications . 9 (1), 2489. PMID: 29950558 Fujita, T., & Fujii.... Biochemical and Biophysical Research Communications . 439 (1), 132–136. PMID: 23942116 Gilbert, L. A...