Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 727 results for: cat.1

Showing: 661 - 690 of 727 results

  1. The Challenges of Cell Culture

    Type
    Blog Post
    ...testing. You can find Nick on LinkedIn. References 1. Skloot, Rebecca, and Bahni Turpin. The immortal life...Marker-independent identification of glioma-initiating cells. The International Cell Line Authentication Committee...propagation of the line, and can include assays for authentication and contamination) and cell lines can become...let alone the human cost. Here are just a few publications which have since been retracted due to cell ...

  2. Plasmids 101: The Promoter Region – Let's Go!

    Type
    Blog Post
    ...mammalian expression from human elongation factor 1 alpha Constitutive  Tends to give consistent expression...resistance gene and the origin of replication are necessary to replicate plasmids and make sure the cells...length version is strong with high expression. Truncated promoters are constitutive with lower expression...metabolic operon Inducible by arabinose and repressed catabolite repression in the presence of glucose or by competitive...

  3. Plasmids 101: Choosing an Antibiotic Resistance Gene

    Type
    Blog Post
    ...antibiotic selection. Essentially, this gene is a 2-in-1 providing both bacterial and eukaryotic selection,...common antibiotic resistance genes and which applications are best (or worst) for each antibiotic. The...is expensive (relative to amp), and for some applications, the benefit it offers is marginal. Fortunately...antibiotic resistance ultimately comes down to your applications and needs. The more niche and specific your ...

  4. New Optimized Genome-wide CRISPRko, CRISPRi, and CRISPRa Libraries

    Type
    Blog Post
    ...such as model systems and primary cells. References 1. Doench, John G., et al. "Rational design of highly...is only effective when sgRNAs target a specific location on the gene. For CRISPRa, sgRNAs were targeted...Calabrese pooled library and lentiviral prep here! Applications for the Root and Doench CRISPR libraries Overall...et al. "A protein-tagging system for signal amplification in gene expression and fluorescence imaging....

  5. The Importance of a Fun Workplace: Company Culture at Addgene

    Type
    Blog Post
    ...fun together! Laura’s Top 10 Event Planning Tips! 1. Take suggestions Some of Addgene’s best events have...be an obvious one, but don’t make things too complicated for yourself (especially if you are the sole ...sole event planner)! If you have a very intricate itinerary, there is a higher likelihood that something ...Delegate- it will save you time and sanity!    10. Communicate Make sure people know that there is something...

  6. Bioinformatics at Addgene

    Type
    Blog Post
    ...drives our bioinformatics needs       Fig. 1: QC'ing data at Addgene is like standing under a Niagara... from depositing laboratories and associated publications, but our quality control (QC) standards have...such as 96-well microplates, and thanks to our dedicated product and development teams, frequent updates...can be easily shared with others without any complicated setup. We created, tested, and debugged each ...

  7. New CRISPR Tools: Cas7-11 and PASTE

    Type
    Blog Post
    ... of low-toxicity RNA editing tools.   Fig. 1 Schematic of luciferase RNA knockdown assays using...experimental design and its potential for clinical applications. Specifically, efficacy rates of Cas7-11 were...place, while increasing the number of potential applications. But they weren’t done engineering quite yet... at the bench and potentially in therapeutic applications. The potential of CRISPR has yet to fully taken...

  8. An Inside Look into Addgene's Dev Team

    Type
    Blog Post
    ... done and we’re onto the next story. Figure 1: Addgene’s Agile Approach Sharing is caring There...diverse group of ethnicities, cultures, genders, educational, and professional backgrounds. Sometimes this... information. It is quite possible that the clarifications lead to the story being scrapped or broken ...While writing the code, we may need additional clarification and again we collaborate with the Product Team...

  9. Plasmids 101: Codon usage bias

    Type
    Blog Post
    ...inclusion bodies and is folding properly. References 1. Angov, Evelina, et al. "Heterologous protein expression...ribosome may therefore stall at inappropriate locations or fail to make it through the entire transcript...generally segregate with the cell pellet during purification procedures. Even if you produce a large amount...

  10. Negotiating Work and Life: How to Find the Joy

    Type
    Blog Post
    ...commandments for making it all work – most of the time. #1 Thou shalt find enjoyment in your work If you are ...other activities. Take care of yourself. Take a vacation alone with your partner – no kids. Get a massage...

  11. Overcoming the AAV Size Limitation for CRISPR Delivery

    Type
    Blog Post
    ...indel formation and phenotypic changes as early as 1 week post-injection. Livers from these mice were histologically...described above showed successful target modification, indicating that AAV is a good delivery vehicle for... with AAV. This system fuses catalytically dead dCas13b to the catalytic domain of RNA deaminase ADAR2...overall packaging capacity but necessitating purification and co-infection of two AAVs. Cas9 orthologs...Streptococcus thermophilus and a rationally-designed truncated Cas9. Unfortunately, certain drawbacks limit the...that limits the number of targetable loci, and truncated Cas9 has much lower efficiency than its wild-type...the AAV-SaCas9-sgRNA constructs mediate genome modification, but they did so without a substantial immune...

  12. Using Video to Share Your Science: We Share Science

    Type
    Blog Post
    ...email Ryan at [email protected]   References 1. Larivière, Vincent, Yves Gingras, and Éric Archambault...be part of the answer. Problems with written publications Online tools like ResearchGate, GoogleScholar... that the big breakthroughs in my discipline, education, will come from ideas garnered from research in...from the science of others. Improving science communication through video     Video abstracts about research... to be that video is the future in terms of communicating ideas. In 2012, for example, 3 billion hours...scientific videos were for entertainment or basic education (i.e., learn why water freezes) there was a growing...video usurps the written word as the means for communicating research. Short videos of 3 to 5 minutes provide...

  13. Transferable Skills Guide: Creativity

    Type
    Blog Post
    ...yourself in a creative rut, read on!   Fig 1: Blugene using creative problem-solving in the lab...resources you’ll need ahead of time and mute your notifications during. (Boyes, 2019) If you’ve taken the time... particularly relevant to you. Elect a devil’s advocate. This is the person whose job it is to disagree...think about alternative options. When a devil’s advocate is elected, others may feel they can share opposing...dissenting opinions or ideas. While the best devil’s advocate is one who truly disagrees with the group (because...adamantly for their solution), selecting a devil’s advocate is a good option for any meeting in which the ...other way,” you probably have reason to continue advocating for your idea. Our product team has implemented...

  14. Filming Science Videos in the Age of Social Distancing

    Type
    Blog Post
    ... over again. Here’s that process!   Figure 1: The Design-Build-Test-Learn cycle adapted for video...Creating great educational science videos is tough. Is the content accurate? Are we conveying complex... had set up involved multiple people in tight locations. Conference rooms for on-screen presenters! Labs...wasn’t going to work for the majority of our educational videos. In addition, it’s really asking a lot...receiver, to beam the camera’s image to my remote location, live. After doing a bit of looking, I found an...

  15. Rett Syndrome: A History of Research and Therapeutic Outlooks

    Type
    Blog Post
    ...therapies to clinical trials in 2021. Figure 1: Schematic of the human MECP2 locus and MECP2 protein...detrimental as too little, resulting in MECP2 duplication syndrome or Rett Syndrome, respectively. One ...Efficient and Precise CRISPR/Cas9-Mediated MECP2 Modifications in Human-Induced Pluripotent Stem Cells. Front..., Hector RD, Cobb SR, Bird A (2017) Radically truncated MeCP2 rescues Rett syndrome-like neurological ...

  16. Four Base Editing Reporters to Monitor and Enrich Editing in Real-time

    Type
    Blog Post
    ...complex. So how exactly does this work? Figure 1: APOBEC- and Cas9-mediated editing (ACE) reporter ...2019). TREE is a real-time, fluorescent based identification system for the isolation of base-edited cell...to BFP Conversion: A Versatile Assay for the Quantification of CRISPR/Cas9-mediated Genome Editing. Molecular...Harris RS (2018) A fluorescent reporter for quantification and enrichment of DNA editing by APOBEC–Cas9...

  17. Transferable Skills Guide: External Collaborations

    Type
    Blog Post
    ...collaborations, keep these jobs in mind! References 1. Sinche, Melanie, et al. "An evidence-based evaluation...hesitation to ‘approach strangers’ and learn how to communicate outside my scientific expertise. Organizing a...will lead! Read our blog post about fostering communication in remote collaborations! Stay in touch: Maintaining...connection is to make sure you keep open lines of communication with colleagues who move on to new organizations...

  19. Antibodies 101: Beyond Surface Labeling

    Type
    Blog Post
    ...and biotin plasmids at Addgene!     Figure 1: Indirect detection of target markers can be achieved...labeling can be subdivided into two categories, depending on the location of the targeted markers. Some commercially...proteins, such as receptors, or post-translational modifications on those proteins, like glycosylation patterns...Depending on the research question and downstream application, one or several of those techniques can be used...your flow analysis. However, certain downstream applications, like an in vivo adoptive transfer of those ...labeling Oftentimes, a marker of interest is not located on the cell membrane but inside the cell. Due to...but preserving the cellular state (think of mummification). Permeabilization, as the name suggests, perforates...

  20. Transferable Skills Guide: Conflict Resolution

    Type
    Blog Post
    ...’re not one of these people yourself.  Fig 1: Quote from Michael Ende, courtesy of morefamousquotes.com...conflict is not always what was communicated but how it was communicated. The next step is to come up with...of lapsed communication. Making some assumptions about how something should be communicated is necessary...skill in and of itself. Conflict can also be categorized as either “personal” or “substantive”. A personality-based...traced back to one of a few trouble spots:  Communication (or lack thereof): Information sharing gets ...organization gets, and creating new avenues of communication can create as many problems as it can solve....meeting? Different teams frequently prefer to communicate in different ways, so the source of the conflict...

  21. Mycoplasma Contamination: Where Does It Come From and How to Prevent It

    Type
    Blog Post
    ... filters. Figure 1: Contamination! Tissue culture media often have indicators included in the media... difficult to eradicate. You can suppress the growth of mycoplasma but cannot eradicate it completely....important to prevent contamination rather than eradicating it later. Don’t be scared when mycoplasma infects...the first person to face this kind of problem. Educate others when you can and help them understand the...Cc, Drexler Hg (2002) Comparative Antibiotic Eradication of Mycoplasma Infections from Continuous Cell...

  22. FLEx Technology and Optogenetics: Flipping the switch on gene expression with high spatial and temporal resolution

    Type
    Blog Post
    ...halorhodopsins to silence neuronal activity (Figure 1) (Wiegert et al., 2017). How to get an opsin into...and Jinfang Zhu. "Immunologic applications of conditional gene modification technology in the mouse." Current...contributed by Alessia Armezzani, scientific communication manager at genOway. A few decades ago, the brain...École Normale Supérieure de Lyon. Her love for educational science led her to pursue a teaching career, ..., and she now is a very happy scientific communication manager at genOway.     Acknowledgement:Through...Bacteriophage P1 site-specific recombination. Purification and properties of the Cre recombinase protein...): 7025-7030. PubMed PMID: 18614669. Belzung, Catherine, Marc Turiault, and Guy Griebel. "Optogenetics...

  23. A Guide to Getting Started in Undergrad Research

    Type
    Blog Post
    ...Bachelor's degree Generally a short-term position (1-2 years) Often a gap-year position taken to transition...entire page dedicated to different career options from science policy to science communication and much ...), about their experiences. Research requires dedication and effort, so building a strong understanding...critically about whether it’s something you want to dedicate your time and energy to. How can I make the most... feel less confident in their abilities and qualifications. Studies on imposter syndrome have also found...universities often have scholarships and funds dedicated for undergraduates interested in doing research...the experience would improve my scientific and application writing skills, and ended up with the award. ...

  24. Finding Your Perfect Job After University

    Type
    Blog Post
    ...experience in cancer research After graduating with a 2:1 BSc in Molecular Biology (roughly a B average in the...at the Institute of Cancer Research in Sutton, located on the edge of London to gain relevant experience...recession. As each advertised job received many applications, employers were requesting that only scientists...commercial company. In my particular situation, communication between departments was sometimes difficult ... order to have meetings between teams. This communication is vital because otherwise I’d lose touch with...

  25. Affinity Purification of Recombinant Antibodies with Protein A or Protein G

    Type
    Protocol
    ...NaH 2 PO 4 ∙H 2 O 1 L deionized water Adjust pH to 7.0 Autoclave or filter sterilize 1 M sodium phosphate...NaH 2 PO 4 ∙H 2 O 1 L deionized water Adjust pH to 7.0 Autoclave or filter sterilize 1 M of sodium phosphate...protease inhibitor cocktail. Add 1 part Protein A/G binding buffer to 1 part tissue culture supernatant...Choose Option 1 or Option 2 based on the concentration of the pooled sample above. Option 1: Buffer exchange...antibody to 1 mg/mL with PBS if needed. For long term storage, add sterile sodium azide to 1 mM. Option...purify recombinant antibodies. Workflow Timeline Day 1: Purify antibody Day 2 or later: Buffer exchange Equipment...°C bead bath Clamp stand and clamps Autoclave 0.1–1 mL single channel pipette 0.5–10 µL single channel...

  26. CRISPR Library Amplification

    Type
    Protocol
    ...Vented Falcon Tubes at 30-37 ℃, 225 rpm for 1 hour. After the 1 hour shaking period, pool and gently mix ...pulse and follow all specifications described in the equipment manual. Immediately add 1 mL SOC to cuvette...Last Update: August 17, 2023 Workflow Timeline Day 1: Transform, recover, set up overnight growth (Estimated... (Default: 4 tubes of Endura Duos, Lucigen, 60242-1) Alternatives include Stbl4 cells or other ultra-high...0.1 cm ) 20 mL SOC recovery media (Lucigen, 80026-1) 8X LB Agar + Antibiotic 245 mm bioassay plates (Molecular...into each of four 14 mL Vented Falcon Tubes and have 1 mL SOC per electroporation readily available for post-electroporation...autoclaved, sterile reagents for all steps. Procedure Day 1 Add 200 ng DNA to each 50 µL aliquot of thawed Endura...

  27. AAV Purification by Iodixanol Gradient Ultracentrifugation

    Type
    Protocol
    ...Preparation 1 M NaCl/PBS-MK buffer Dissolve 5.84 g of NaCl, 26.3 mg of MgCl 2 and 14.91 mg of KCl in 1× PBS ...iodixanol column gradient for AAV purification. Workflow Timeline Day 1: Purify Day 2: Buffer exchange and...cartoon indicating the position of the needle for harvesting of the purified AAV using option #1. Right...Dissolve 26.3 mg of MgCl 2 , and 14.91 mg of KCl in 1× PBS in a final volume of 100 mL. Sterilize by passing... step: mix 4.5 mL of 60% iodixanol and 13.5 mL of 1 M NaCl/PBS-MK buffer 25% iodixanol step: mix 5 mL ...Hamilton needle, taking care to avoid bubbles (Figure 1). 8 mL of 15% iodixanol step 5 mL of 25% iodixanol...disturb the gradient!** Collect Fractions Option #1 Prepare a row of roughly 20 open 1.5 mL microcentrifuge...

  28. Plasmid Modification by Annealed Oligo Cloning (with Protocols)

    Type
    Protocol
    ...annealing can be achieved by one of two methods: Method #1 Place the mixed oligos in a 1.5mL microfuge tube. ...vector in molar ratios (vector:insert) between 4:3 and 1:6 in a standard ligation reaction (ex. to ligate an... Protocols Plasmid Modification by Annealed Oligo Cloning Plasmid Modification by Annealed Oligo Cloning...' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3'...each of the additional sites in tandem ( NdeI - CATATG , PacI - TTAATTAA , AscI - GGCGCGCC , MfeI - CAATTG...compliment so that they can anneal. Top oligo: 5' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo... final oligos 34 bp each: Top oligo: 5' - AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3...

  29. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...of Contents A. pLKO.1-TRC Cloning Vector A.1 The RNAi Consortium A.2 Map of pLKO.1 A.3 Related plasmids...Order oligos compatible with pLKO.1 C. Cloning shRNA oligos into pLKO.1 C.1 Recommended materials C.2 Annealing... References H.1 Published articles H.2 Web resources I. Appendix I.1 Sequence of pLKO.1 TRC-Cloning Vector...information Back to Top A. pLKO.1-TRC Cloning Vector A.1 The RNAi Consortium The pLKO.1 cloning vector is the backbone...marker encoded in pLKO.1 allows for convenient stable selection. Figure 1 : Map of pLKO.1 containing an shRNA...puromycin should be from 1-10 μg/mL in 1 μg/mL increments. d. Label plates from 1-10 and add appropriate...Appendix I.1. Sequence of pLKO.1 TRC-Cloning Vector Click here to see the sequence of pLKO.1 TRC-cloning...

  30. Lentivirus Production

    Type
    Protocol
    ...DNA μL of 1 mg/mL PEI 1:1 18.9 18.9 1:2 18.9 37.8 1:3 18.9 56.7 1:4 18.9 75.6 1:5 18.9 94.5 1:6 18.9 113.4...μg total DNA to μg PEI ratios of 1:1, 1:2, 1:3 and 1:6. The 1:2 and 1:3 total DNA:PEI μg ratios provided...: Monday: Plate 1×10 6 cells in a T75 flask in 15 mL DMEM Complete. Wednesday: Plate 1×10 6 cells in a...Workflow Timeline Day 0: Seed 293T packaging cells Day 1 (pm): Transfect packaging cells Day 2 (am): 18 h post-transfection...inactivated in the lab by heating to 56°C for 30 min. 1 mg/mL polyethylenimine, linear MW 25,000 Da (PEI) ...to be empirically determined for each new batch of 1 mg/mL PEI and for each cell line. Considerations Before...enough PEI such that the ratio of μg DNA:μg PEI is 1:3 (1000 μL total per 10 cm dish). Using transfer plasmid...
Showing: 661 - 690 of 727 results