Skip to main content

We narrowed to 502 results for: plasmid dna

Showing: 481 - 500 of 502 results
  1. Modular Cloning Guide

    Type
    Guide
    ...You may also like... Plasmid Kits Blog: Plasmids 101 Modular Cloning Blog: Plasmids 101 Modular Cloning...Applications and Kits Blog: Plasmids 101 Golden Gate Cloning Synthetic Biology Plasmids Modular Cloning (or MoClo...for efficiently assembling multiple DNA parts into functional plasmids. It is a powerful and very efficient...recognition site, leaving DNA fragments with an overhang of 4 bp. If each DNA module is flanked with a ...Parrott 48 plasmids compatible with the GreenGate Cloning System (Lohmann) to create plasmids with multi-gene...Expression Tomáš Pluskal Plasmid kit for assembly of single-gene and multigene plasmids for genome integration... with plasmids from the MoClo-YTK . MoClo Pichia Toolkit Yeast Expression Volker Sieber Plasmids with ...
  2. Plan Your Experiment

    Type
    Guide
    ...generate stable cell lines if your plasmid contains a selection marker. Plasmid delivery is versatile thanks...more than just the DNA sequence. If this is the case, you can confirm your edit using DNA-based methods like...Application Cas Enzyme Additional Considerations Browse Plasmids Knockout Permanently disrupt gene function; cells...mutations or small tag insertions, by copying from a DNA donor template Cas9 or Cas9 fusions with proteins...different activator systems exist, including the multi-plasmid SAM system Activate Design and Clone Your gRNA ...efficiency . Remember that HDR also requires donor DNA to serve as template for the repair. Once you settle...settle on your gRNA, you can design a donor DNA to have the appropriate left and right homology arms. See...
  3. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...Gamma-Retroviral Plasmid Elements Plasmid Type Element Delivery relative to transgene Purpose Transfer plasmid LTR ...transcribed into DNA before being integrated in the genome of a host. Going from RNA to DNA is the reverse... of all gamma-retroviral plasmid components, see the Gamma-Retroviral Plasmid Elements table . In order...gamma-retroviral vectors, you need three plasmids (Figure 2): Transfer plasmid — contains transgene, sgRNA, or ...capacity Packaging plasmid — contains packaging genes gag and pol Envelope plasmid — contains packaging...chosen plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be ... often results in a greater yield of DNA. However, if the plasmid contains a Gateway cassette containing...
  4. Guide to Using Pooled Libraries

    Type
    Guide
    ... Science Guides Plasmid Pooled Libraries Guide to Plasmid Pooled Libraries Types of Libraries...consist of a single mixture of many different plasmids. Plasmids within a given library have the same backbone...addgene.org for assistance. For some libraries, plasmid DNA can be delivered directly to the cells of interest... others, notably pooled lentiviral plasmid libraries, the plasmids must first be used to make viral vectors...deliver the plasmids to the cells of interest. In either case, NGS of the amplified library DNA is recommended...transduced cell receives only one plasmid. To make sure that every plasmid is adequately represented in the... given plasmid, think of each cell carrying it as being a biological replicate for that plasmid. Library...
  5. Lentiviral Vector Guide

    Type
    Guide
    ...second-generation transfer plasmids as well. Third-generation plasmids include (Figure 4): Transfer plasmid — contains...Packaging plasmid 1 — contains gag and pol Packaging plasmid 2 — contains rev Envelope plasmid — contains...systems Packaging Plasmid One plasmid encoding gag , pol , tat , and rev Two plasmids, one encoding gag...Lentiviral Plasmid Elements Plasmid Type Element Delivery relative to transgene Purpose Transfer plasmid LTR ...transcribed into DNA before being integrated in the genome of a host. Going from RNA to DNA is the reverse...separated into distinct plasmids for safety. For a summary of all lentiviral plasmid components, see the ...four, for third generation) plasmids: Transfer plasmid — contains transgene, sgRNA, or shRNA of interest ...
  6. Antibody Guide

    Type
    Guide
    ...little variation. Recombinant plasmids - Antibodies can be produced from plasmids, with an antibody’s genetic... genes from specific hybridoma cells into plasmids. Plasmids are then transfected into cells and induced...interactions between DNA and protein. Micrococcal nuclease digestion is used to shear the DNA in these assays... uses antibodies to capture protein:DNA complexes. After capture, the DNA is released from the complex...suitable for DNA:histone modifier interactions, which have strong binding between the protein and DNA. Some ...immune cells, or through the use of recombinant plasmids. Animals - Antibodies produced in animals make...genetic code inserted into the plasmid. This produces the least amount of variation between antibodies, allows...
  7. Sequencing Primers

    Type
    Guide
    ...additional information on molecular biology, plasmids, and recombinant DNA, please consult Addgene's Molecular ...mainly uses next-generation sequencing (NGS) for plasmid verification, Addgene has used a number of primers...useful in your sequencing reaction, find your plasmid’s page and see what primers are listed under "5'...questions about choosing the best primer for your plasmid? Email us at [email protected] . For additional ...Forward Gal4 N-term GAGTAGTAACAAAGGTCAA 3' end of Gal4 DNA binding domain Forward Gal4-AD AATACCACTACAATGGAT...Reverse LexA CGTCAGCAGAGCTTCACCATTG 3' end of LexA DNA binding domain Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT...GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids Forward pCasper-F GGGTTTTATTAACTTACAT 5' end of...
  8. Optogenetics Guide

    Type
    Guide
    ...exhaustive — check out our Optogenetics Plasmid Collection to find plasmids for these and other tools for your...Explore Addgene's Optogenetics Plasmid Collection to find the plasmids you need. Looking for viral preps...Learn about using Optogenetics plasmids in your lab, including microbial opsins and optical switch systems...practical tips , explore Addgene's Optogenetics Plasmid Collection , or read on to learn more about these...fused to a transcriptional activation domain and DNA binding domain, allowing light to activate transcription...target proteins 450 EL222 Homodimerizes and binds to DNA upon blue light illumination, reverses in dark 450...
  9. Arf GTPase Family

    Type
    Collection
    ... Richard Kahn Lab Plasmids GTPase Plasmids GAP and GEF Plasmids References The ARF (ADP-ribosylation factor...examples of plasmid types available for each gene. Click the gene name for a full list of plasmids available...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...ARF family plasmids. ARF family members include regulatory GTPases, GEFs, and GAPs. Plasmid... Plasmid Collections...Collections ARF Superfamily Plasmids for ARF Superfamily Research You may also like... RAS Clone Collections Richard...
  10. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Fluorescent Protein Collection Luciferase Plasmid Collection Promega Plasmid Collection Botman-Teusink Yeast Fluorescent...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail... Maturation Structure Plasmids EYFP 513 527 51 6.9 Prone to dimerization pcDNA3-YFP - Mammalian Expression...Maturation Structure Plasmids Dendra2 490 553 507 573 405 23 19 6.6 6.9 Monomer pcDNA3.1 Dendra2 - Mammalian...Explore empty plasmid backbones with different fluorescent tags to create fusion proteins with your gene... Plasmid Collections Fluorescent Proteins Empty Backbones Fluorescent Proteins: Empty...compiled from FPbase (Link opens in a new window) or plasmids' original publications. Note for all tables: Brightness...
  11. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Neurodegeneration Neurodegeneration Plasmids Neurodegeneration Plasmid Collection Addgene has a large collection...Meyer 114193 pc DNA FRT TO- APP695 APP CMV Alzheimer's Aleksandra Radenovic 114194 pc DNA FRT TO- APPSwed...Browse all Neurodegeneration Plasmids Do you have suggestions for other plasmids that should be added to this...Trimmer 197107 iYFP-Parkin Plasmid PRKN YFP TRE Parkinson's Dori Woods 197146 pcDNA3-ApoE2 APOE CMV Alzheimer's...Browse neurodegeneration plasmids for research related to Alzheimer's Disease, ALS, Frontotemporal Dementia...collection of neurodegeneration plasmids for research related to Alzheimer's Disease (AD), Amyotrophic...others. The table below can be sorted by disease, plasmid type, mutations, and/or tags such as fluorescent...
  12. Lentivirus Plasmids

    Type
    Collection
    ... Viral Plasmids Lentiviral Plasmids Lentiviral Plasmids Transfer Plasmids Packaging ...Packaging Plasmids Envelope Plasmids Resources Lentiviruses, a subset of retroviruses, are some of the most common...(a virion) are divided among multiple plasmids: Transfer plasmid — contains transgene, sgRNA, or shRNA...flanked by LTRs Packaging plasmid — contains packaging and regulatory genes; one plasmid in second-generation...second-generation, two plasmids in third-generation Envelope plasmid — contains packaging gene env This collection highlights...Guide Popular Lentiviral Transfer Plasmids Looking for lentiviral plasmids to express a CRISPR gRNA? Browse...catalog for lentiviral CRISPR plasmids for gRNA expression . ID Plasmid Generation Description PI 8453...
  13. Fluorescent Proteins: FRET

    Type
    Collection
    ...backbones and control plasmids. Donor Acceptor λ Dex QY D λ Aem ε A QY A R 0 J(λ) Plasmids mTagBFP sfGFP 399.... Browse Addgene's Luciferase Plasmid Collection or the Promega Plasmid Collection to find related tools...Find plasmids and resources for FRET experiments to measure protein interactions or conformation changes... Plasmid Collections Fluorescent Proteins FRET Fluorescent Proteins: FRET FRET Pairs FRET Calibration...FRET on our blog and explore the tables below for plasmids and information to help plan your next FRET experiment...The articles or collections listed below feature plasmids with positive and negative FRET controls or calibration... the cpFRET kit from the Pertz Lab or the 2in1 Plasmid Toolkit from the Grefen Lab. FRET pairs and biosensors...
  14. Fluorescent Protein Guide: In Vivo Imaging

    Type
    Collection
    ...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...nm) Brightness Plasmids mCardinal 604 659 18 pcDNA3-mCardinal mNeptune2 600 650 21 pcDNA3-mNeptune2 mNeptune2...Find plasmids for in vivo imaging using far red, near-infrared, and photoactivatable fluorescent proteins... Plasmid Collections Fluorescent Proteins In Vivo Imaging Fluorescent Proteins: In Vivo Imaging...compiled from FPbase (Link opens in a new window) or plasmids' original publications. Far-Red Protein Excitation...Protein Excitation (nm) Emission (nm) Brightness Plasmids emiRFP670 642 670 12 pemiRFP670-N1 miRFP670 642... (nm) Emission (nm) Activation (nm) Brightness Plasmids PAiRFP1 690 717 660 or 750 3.2 pPAiRFP1-N1 PAiRFP2...
  15. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...Find plasmids encoding fluorescent fusion proteins with known subcellular localization patterns for colocalization... Plasmid Collections Fluorescent Proteins Subcellular Localization...to a red fluorescent protein like mCherry (find plasmids for cloning in our Fluorescent Proteins Empty ...general cellular organelles and structures. ID Plasmid Structure Targeting Gene/Signal Fluorescent Protein...below to find markers of cytoskeletal elements. ID Plasmid Structure Targeting Gene/Signal Fluorescent Protein...below to find markers for cellular junctions. ID Plasmid Structure Targeting Gene/Signal Fluorescent Protein...
  16. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...NeuroMab/Trimmer Lab Plasmid Collection R-mAb Plasmids scFv Plasmids Nanobody Plasmids Protocols References... Antibody Plasmid Collection NeuroMab Plasmid Collection... the plasmid, followed by the SV40 polyA tail (SV40 pA). Recombinant Monoclonal Antibody Plasmid Collection...following plasmids can be used to produce R-mAbs from transfected mammalian cells. Addgene ID Plasmid Target...partner labs. Learn More scFv Plasmid Collection The following plasmids can be used to produce scFvs from... Pan-GRK Mouse Mouse Nanobody Plasmid Collection The following plasmids can be used to produce nanobodies...research. Find plasmids encoding these R-mAbs here. Antibody...
  17. Plasmid Collections

    Type
    Collection
    ...Homepage Plasmid Collections Addgene Plasmid Collections Addgene's repository contains 170,822 plasmids . We've...you are looking for a non-plasmid item, browse our entire repository . Plasmid Resources Our curated resources...resources group plasmids together based on type or application. Browse our guides to find the plasmids and science...Viral Plasmids Lentivirus Adeno-associated Virus (AAV) γ-Retrovirus Adenovirus All Viral Plasmids Curated...Consortium Krüppel-like factors (KLF) Plasmid Resource RESOLUTE Plasmid Collection for Solute Carrier Proteins... Find deposited plasmids for specific disease research areas. Cancer Research Plasmids and Resource Michael... Syndrome Plasmid Collection and Resource Center Do you have suggestions for other plasmids that should...
  18. Cancer Research Plasmids and Resources

    Type
    Collection
    ...component to find plasmids with your gene of interest. Browse Cancer Research Plasmids by Pathway mTOR ...Addgene's curated collection of plasmids for cancer research, organized by signaling pathway. Special...Special Collections Cancer Research Cancer Research Plasmids and Resources Addgene has a large variety of resources...Each collection page listed below organizes the plasmids and resources by signaling pathway, focusing on...Libraries for Cancer Research Broad Target Accelerator Plasmids: Collection of vectors from the Boehm , Hahn ,...vectors from the Sabatini & Wood Labs containing cDNAs for studying oncogenic signaling pathways. ClonTracer...
  19. Retrovirus Plasmids

    Type
    Collection
    ...Gamma-Retroviral Plasmids Gamma-Retroviral Plasmids Transfer Plasmids Packaging Plasmids Envelope Plasmids Additional...transfer plasmids that have inserts. ID Plasmid 5'LTR Description PI 1780 pBABE-neo largeTcDNA MoMLV Expression...retroviral plasmids at Addgene, including popular packaging, envelope, and transfer plasmids. Viral...particles have been split into multiple plasmids for safety: Transfer plasmid — contains transgene, sgRNA, or ...flanked by LTRs Packaging plasmid — contains packaging genes Envelope plasmid — contains packaging gene...Popular Gamma-Retroviral Transfer Plasmids Want a retroviral plasmid with your gene of interest? Search...of immortalized cells. See plasmid 1771 for puromycin selection, and plasmid 1774 for neomycin selection...
Showing: 481 - 500 of 502 results