We narrowed to 498 results for: plasmid dna

... In cDNA libraries, each plasmid contains a unique cDNA. In shRNA or gRNA libraries, each plasmid contains... Science Guides Guide to Plasmid Pooled Libraries Plasmid Pooled Libraries Jump To: Pooled Library...are single preparations of many different plasmids. Plasmids within a given library have the same backbone...protocol for the best results. For some libraries, plasmid DNA can be delivered directly to the cells of interest... others, notably pooled lentiviral plasmid libraries, the plasmids must first be used to make virus. This...infected cell receives only one plasmid. To make sure that every plasmid is adequately represented in the... given plasmid, think of each cell carrying it as being a biological replicate for that plasmid. Library...

...second-generation transfer plasmids as well. Third-generation plasmids include (Figure 4): Transfer plasmid — contains...Packaging plasmid 1 — contains gag and pol Packaging plasmid 2 — contains rev Envelope plasmid — contains...systems Packaging Plasmid One plasmid encoding gag , pol , tat , and rev Two plasmids, one encoding gag...Lentiviral Plasmid Elements Plasmid Type Element Delivery relative to transgene Purpose Transfer plasmid LTR ...transcribed into DNA before being integrated in the genome of a host. Going from RNA to DNA is the reverse...separated into distinct plasmids for safety. For a summary of all lentiviral plasmid components, see the ...four, for third generation) plasmids: Transfer plasmid — contains transgene, sgRNA, or shRNA of interest ...

...little variation. Recombinant plasmids - Antibodies can be produced from plasmids, with an antibody’s genetic... genes from specific hybridoma cells into plasmids. Plasmids are then transfected into cells and induced...interactions between DNA and protein. Micrococcal nuclease digestion is used to shear the DNA in these assays... uses antibodies to capture protein:DNA complexes. After capture, the DNA is released from the complex...suitable for DNA:histone modifier interactions, which have strong binding between the protein and DNA. Some ...immune cells, or through the use of recombinant plasmids. Animals - Antibodies produced in animals make...genetic code inserted into the plasmid. This produces the least amount of variation between antibodies, allows...

...additional information on molecular biology, plasmids, and recombinant DNA, please consult Addgene's Molecular ...mainly uses next-generation sequencing (NGS) for plasmid verification, Addgene has used a number of primers...useful in your sequencing reaction, find your plasmid’s page and see what primers are listed under "5'...questions about choosing the best primer for your plasmid? Email us at [email protected] . For additional ...Forward Gal4 N-term GAGTAGTAACAAAGGTCAA 3' end of Gal4 DNA binding domain Forward Gal4-AD AATACCACTACAATGGAT...Reverse LexA CGTCAGCAGAGCTTCACCATTG 3' end of LexA DNA binding domain Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT...GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids Forward pCasper-F GGGTTTTATTAACTTACAT 5' end of...

...Explore Addgene's Optogenetics Plasmid Collection to find the plasmids you need. Looking for viral preps...domain (iLID plasmid), while its natural binding partner SspB is included in a separate plasmid; Blue light...Addgene's guide to using Optogenetics plasmids in your lab, including explanations of microbial opsin... learn more, or explore Addgene's Optogenetics Plasmid Collection . An optogenetics procedure. A channelrhodopsin...indicators or voltage sensors, visit our Biosensors Plasmid Collection . Microbial Opsins Opsins are light-...not exhaustive — please browse our Optogenetics Plasmid Collection to find the right tools for your experiments...ready-to-use AAV preparations of many optogenetics plasmids. Optical Switches Researchers have harnessed plant...

... Richard Kahn Lab Plasmids GTPase Plasmids GAP and GEF Plasmids References The ARF (ADP-ribosylation factor...examples of plasmid types available for each gene. Click the gene name for a full list of plasmids available...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...ARF family plasmids. ARF family members include regulatory GTPases, GEFs, and GAPs. Plasmid... Plasmid Collections...Collections ARF Superfamily Plasmids for ARF Superfamily Research You may also like... RAS Clone Collections Richard...

...Fluorescent Protein Collection Luciferase Plasmid Collection Promega Plasmid Collection Botman-Teusink Yeast Fluorescent...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail... Maturation Structure Plasmids EYFP 513 527 51 6.9 Prone to dimerization pcDNA3-YFP - Mammalian Expression...Maturation Structure Plasmids Dendra2 490 553 507 573 405 23 19 6.6 6.9 Monomer pcDNA3.1 Dendra2 - Mammalian...Explore empty plasmid backbones with different fluorescent tags to create fusion proteins with your gene... Plasmid Collections Fluorescent Proteins Empty Backbones Fluorescent Proteins: Empty...Emission (nm) Brightness pKa Maturation Structure Plasmids Sirius 355 424 4 3.0 Prone to dimerization Sirius-N1...

...Neurodegeneration Neurodegeneration Plasmids Neurodegeneration Plasmid Collection Addgene has a large collection...Meyer 114193 pc DNA FRT TO- APP695 APP CMV Alzheimer's Aleksandra Radenovic 114194 pc DNA FRT TO- APPSwed...Browse all Neurodegeneration Plasmids Do you have suggestions for other plasmids that should be added to this...Trimmer 197107 iYFP-Parkin Plasmid PRKN YFP TRE Parkinson's Dori Woods 197146 pcDNA3-ApoE2 APOE CMV Alzheimer's...Browse neurodegeneration plasmids for research related to Alzheimer's Disease, ALS, Frontotemporal Dementia...collection of neurodegeneration plasmids for research related to Alzheimer's Disease (AD), Amyotrophic...others. The table below can be sorted by disease, plasmid type, mutations, and/or tags such as fluorescent...

... Viral Plasmids Lentiviral Plasmids Lentiviral Plasmids Transfer Plasmids Packaging ...Packaging Plasmids Envelope Plasmids Resources Lentiviruses, a subset of retroviruses, are some of the most common...(a virion) are divided among multiple plasmids: Transfer plasmid — contains transgene, sgRNA, or shRNA...flanked by LTRs Packaging plasmid — contains packaging and regulatory genes; one plasmid in second-generation...second-generation, two plasmids in third-generation Envelope plasmid — contains packaging gene env This collection highlights...Guide Popular Lentiviral Transfer Plasmids Looking for lentiviral plasmids to express a CRISPR gRNA? Browse...catalog for lentiviral CRISPR plasmids for gRNA expression . ID Plasmid Generation Description PI 8453...

...backbones and control plasmids. Donor Acceptor λ Dex QY D λ Aem ε A QY A R 0 J(λ) Plasmids mTagBFP sfGFP 399.... Browse Addgene's Luciferase Plasmid Collection or the Promega Plasmid Collection to find related tools...Find plasmids and resources for FRET experiments to measure protein interactions or conformation changes... Plasmid Collections Fluorescent Proteins FRET Fluorescent Proteins: FRET FRET Pairs FRET Calibration...FRET on our blog and explore the tables below for plasmids and information to help plan your next FRET experiment...The articles or collections listed below feature plasmids with positive and negative FRET controls or calibration... the cpFRET kit from the Pertz Lab or the 2in1 Plasmid Toolkit from the Grefen Lab. FRET pairs and biosensors...

...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...nm) Brightness Plasmids mCardinal 604 659 18 pcDNA3-mCardinal mNeptune2 600 650 21 pcDNA3-mNeptune2 mNeptune2...Find plasmids for in vivo imaging using far red, near-infrared, and photoactivatable fluorescent proteins... Plasmid Collections Fluorescent Proteins In Vivo Imaging Fluorescent Proteins: In Vivo Imaging...Protein Excitation (nm) Emission (nm) Brightness Plasmids emiRFP670 642 670 12 pemiRFP670-N1 miRFP670 642... (nm) Emission (nm) Activation (nm) Brightness Plasmids PAiRFP1 690 717 660 or 750 3.2 pPAiRFP1-N1 PAiRFP2... Proteins: Subcellular Localization Luciferase Plasmid Collection Viral Vector Packaging Service Content...

...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...Find plasmids encoding fluorescent fusion proteins with known subcellular localization patterns for colocalization... Plasmid Collections Fluorescent Proteins Subcellular Localization...to a red fluorescent protein like mCherry (find plasmids for cloning in our Fluorescent Proteins Empty ...general cellular organelles and structures. ID Plasmid Structure Targeting Gene/Signal Fluorescent Protein...below to find markers of cytoskeletal elements. ID Plasmid Structure Targeting Gene/Signal Fluorescent Protein...below to find markers for cellular junctions. ID Plasmid Structure Targeting Gene/Signal Fluorescent Protein...

...NeuroMab/Trimmer Lab Plasmid Collection R-mAb Plasmids scFv Plasmids Nanobody Plasmids Protocols References... Antibody Plasmid Collection NeuroMab Plasmid Collection... the plasmid, followed by the SV40 polyA tail (SV40 pA). Recombinant Monoclonal Antibody Plasmid Collection...following plasmids can be used to produce R-mAbs from transfected mammalian cells. Addgene ID Plasmid Target...partner labs. Learn More scFv Plasmid Collection The following plasmids can be used to produce scFvs from... Pan-GRK Mouse Mouse Nanobody Plasmid Collection The following plasmids can be used to produce nanobodies...research. Find plasmids encoding these R-mAbs here. Antibody...

...Homepage Plasmid Collections Addgene Plasmid Collections Addgene's repository contains 167,150 plasmids . We've...you are looking for a non-plasmid item, browse our entire repository . Plasmid Resources Our curated resources...resources group plasmids together based on type or application. Browse our guides to find the plasmids and science...Viral Plasmids Lentivirus Adeno-associated Virus (AAV) γ-Retrovirus Adenovirus All Viral Plasmids Curated...Consortium Krüppel-like factors (KLF) Plasmid Resource RESOLUTE Plasmid Collection for Solute Carrier Proteins... Find deposited plasmids for specific disease research areas. Cancer Research Plasmids and Resource Michael... Syndrome Plasmid Collection and Resource Center Do you have suggestions for other plasmids that should...

...component to find plasmids with your gene of interest. Browse Cancer Research Plasmids by Pathway mTOR ...Addgene's curated collection of plasmids for cancer research, organized by signaling pathway. Special...Special Collections Cancer Research Cancer Research Plasmids and Resources Addgene has a large variety of resources...Each collection page listed below organizes the plasmids and resources by signaling pathway, focusing on...Libraries for Cancer Research Broad Target Accelerator Plasmids: Collection of vectors from the Boehm , Hahn ,...vectors from the Sabatini & Wood Labs containing cDNAs for studying oncogenic signaling pathways. ClonTracer...

...Gamma-Retroviral Plasmids Gamma-Retroviral Plasmids Transfer Plasmids Packaging Plasmids Envelope Plasmids Additional...transfer plasmids that have inserts. ID Plasmid 5'LTR Description PI 1780 pBABE-neo largeTcDNA MoMLV Expression...retroviral plasmids at Addgene, including popular packaging, envelope, and transfer plasmids. Viral...particles have been split into multiple plasmids for safety: Transfer plasmid — contains transgene, sgRNA, or ...flanked by LTRs Packaging plasmid — contains packaging genes Envelope plasmid — contains packaging gene...Popular Gamma-Retroviral Transfer Plasmids Want a retroviral plasmid with your gene of interest? Search...of immortalized cells. See plasmid 1771 for puromycin selection, and plasmid 1774 for neomycin selection...

...and Myers Tagging Plasmids Protein Species Tag Donor Plasmid gRNA plasmid gRNA plasmid FLAG pFETCh_Donor.... Multiple gRNA plasmids may be used. The HDR (homology directed repair) donor plasmid with homology arms...individual tagging event. The kit contains 26 plasmids; 21 of the plasmids are for use in SapTrap reactions for...the remaining 5 plasmids include Cre and FLP expression vectors, a general cloning plasmid, and a prebuilt...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...CRISPR plasmids for endogenous tagging of your gene of interest. CRISPR...Plasmids - Protein Tagging Browse CRISPR Plasmids By Function Genome Editing Cut Base Edit Nick Prime Edit...

... Plasmid Collections Immunology Research Immunology Research Plasmids and Resources You...Fluorescent Proteins Cancer Research Plasmids Gene Categories Plasmid Tables Additional Resources Mammalian...to the available plasmids for each gene. Please note that not all genes have plasmids available for request...and apoptosis. Plasmid Tables The gene names in these tables link to the available plasmids for each gene...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...Addgene’s immunology collection contains plasmids for genes involved in innate and adaptive immune signaling...rapidly initiate a secondary immune response. Browse Plasmids for Immunology Research Genes have been grouped...