Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 542 results for: SHI

Showing: 521 - 540 of 542 results

  12. Deep Dive: qPCR

    Type
    Blog Post
    ...Huggett J; Kubista M; Mueller R; Nolan T; Pfaffl MW; Shipley GL; Vandesompele J; Wittwer CT. The MIQE guidelines...

  14. Optogenetics Guide

    Type
    Guide
    ...PsChR1 Red-shifted chloride-conducting channel from Proteomonas sulcata 540 Phobos Blue-shifted iC++ variant...467 Aurora Red-shifted anion-selective ReaChR variant 517 Halorhodopsins Jaws Red-shifted, light-driven...kinetics: Examples: ChETA, C1V1(t/t), ChrimsonR Red-shifted peak action spectra Examples: VChR1, C1V1(t/t),...amplitude Examples: eNpHR, eNpHR2.0, eNpHR3.0 Red-shifted peak action spectra Example: Jaws Browse Halorhodopsin...K176R mutation. 590 PsChR2 High-efficiency blue-shifted channelrhodopsin from Platymonas subcordiformis...2014. Noninvasive optical inhibition with a red-shifted microbial rhodopsin. Nat Neurosci. 17(8):1123-9... Yizhar O, Hegemann P, Deisseroth K. 2008. Red-shifted optogenetic excitation: a tool for fast neural ...

  15. Chemogenetics Guide

    Type
    Guide
    ... K, Ji B, Takahashi M, Huang X-P, Slocum ST, DiBerto JF, Xiong Y, Urushihata T, Hirabayashi T, Fujimoto..., Jin J (2015). The First Structure–Activity Relationship Studies for Designer Receptors Exclusively Activated...English JG, Liu J, Inoue K, Kumata K, Seki C, Ono M, Shimojo M, Zhang M-R, Tomita Y, Nakahara J, Suhara T, Takada...

  16. Modular Cloning Guide

    Type
    Guide
    ...Genome Engineering, CRISPR, Mammalian Expression Takashi Yamamoto Plasmids for construction of all-in-one...TALEN Accessory Pack Genome Engineering, TALEN Takashi Yamamoto Nine pFUS array vectors and destination...Platinum Gate TALEN Kit Genome Engineering, TALEN Takashi Yamamoto Plasmids for construction of highly-active...

  17. Plan Your Experiment

    Type
    Guide
    ...mRNA due to alternative splicing, and an early frameshift mutation is more likely to result in a non-functional....org/10.1038/s41587-020-0490-7 PMID: 29305085 Hashimoto, M., & Takemoto, T. (2015). Electroporation enables...

  18. Antibody Guide

    Type
    Guide
    ...price, and other factors like availability and shipping time. Choose antibodies from companies that are...several to compare, or select one based on price, shipping availability, ease of purchase, or similar factors...

  19. Sequencing Primers

    Type
    Guide
    ...-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP vs EYFP, reverse primer F1ori-...

  20. Adenovirus Guide

    Type
    Guide
    ...24533227 (Link opens in a new window) Watanabe, M., Nishikawaji, Y., Kawakami, H., & Kosai, K. I. (2021). Adenovirus...
Showing: 521 - 540 of 542 results