We narrowed to 537 results for: SHI

1. Deep Dive: Statistical Tests (Comparisons)

   Type

   Blog Post

   ... of comparisons. The Bonferroni does this by establishing a significance threshold at a p value less than...

2. Sequencing Options for CRISPR Genotyping

   Type

   Blog Post

   ...genotyping, is critical to demonstrating causal relationships between genotype and assayed phenotype. Verifying...

3. Chemogenetics Guide

   Type

   Guide

   ... K, Ji B, Takahashi M, Huang X-P, Slocum ST, DiBerto JF, Xiong Y, Urushihata T, Hirabayashi T, Fujimoto..., Jin J (2015). The First Structure–Activity Relationship Studies for Designer Receptors Exclusively Activated...English JG, Liu J, Inoue K, Kumata K, Seki C, Ono M, Shimojo M, Zhang M-R, Tomita Y, Nakahara J, Suhara T, Takada...

4. Fluorescent Proteins 101: Monitoring Cell Mobility Using Fluorescent Proteins

   Type

   Blog Post

   ...appropriate containers. The machine is useful for distinguishing cell populations that have been tagged with...

5. Hassle-free 96-well Format Epitope Tagging Using Cas9 Ribonucleoprotein

   Type

   Blog Post

   ...primers flanking the tag sequence and expect a size-shift in the PCR product for knock-in lines. Troubleshooting...

6. CRISPR 101: Multiplex Expression of gRNAs

   Type

   Blog Post

   ...plasmids from this paper at Addgene. 3. Sakuma, Tetsushi, et al. “Multiplex genome engineering in human...

7. Antibody Validation for Flow Cytometry

   Type

   Blog Post

   ... of an orthogonal approach to understand the relationship between antibody staining intensity by flow ...

8. The CRISPR Software Matchmaker: A New Tool for Choosing the Best CRISPR Software for Your Needs

   Type

   Blog Post

   ...software. This category is important for users wishing to select tools based on their comfort level with...

9. Delivery Methods for Generating iPSCs

   Type

   Blog Post

   ...Masayuki, Minoru Iijima, Manami Ohtaka, and Mahito Nakanishi. "Novel Strategy to Control Transgene Expression...

10. Deep Dive: qPCR

    Type

    Blog Post

    ...Huggett J; Kubista M; Mueller R; Nolan T; Pfaffl MW; Shipley GL; Vandesompele J; Wittwer CT. The MIQE guidelines...

11. CRISPR Methods for Bacteria: Genome Engineering, CRISPRa, CRISPRi, Base Editing, and More

    Type

    Blog Post

    ...bacterial CRISPR engineering One common way of accomplishing bacterial genome engineering is done with recombineering...

12. Plan Your Experiment

    Type

    Guide

    ... Exons near the N-terminus are targeted since frameshift mutations here increase the likelihood that a...The benefit of this approach is that even non-frameshift alleles may alter protein function when they ...Molecular Biology . 1239 , 197–217. PMID: 25408407 Hashimoto, M., & Takemoto, T. (2015). Electroporation enables...

13. Antibody Guide

    Type

    Guide

    ...price, and other factors like availability and shipping time. Choose antibodies from companies that are...several to compare, or select one based on price, shipping availability, ease of purchase, or similar factors...

14. Sequencing Primers

    Type

    Guide

    ...-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP vs EYFP, reverse primer F1ori-...

15. Adenovirus Guide

    Type

    Guide

    ...24533227 (Link opens in a new window) Watanabe, M., Nishikawaji, Y., Kawakami, H., & Kosai, K. I. (2021). Adenovirus...

16. Molecular Biology Reference

    Type

    Guide

    ..., and thus the plasmid exists in a symbiotic relationship with the host cell. Like the bacterial chromosomal...

17. Adeno-associated virus (AAV) Guide

    Type

    Guide

    ...) PMID: 39322487 (Link opens in a new window) Matsushita, T., Okada, T., Inaba, T., Mizukami, H., Ozawa...