We narrowed to 10 results for: SHI

..., 156 (5), 935–949. PMID: 24529477 Nishimasu, H., Shi, X., Ishiguro, S., Gao, L., Hirano, S., Okazaki,...Wang, H., Yang, H., Shi, L., Katz, Y., Theunissen, T. W., Rangarajan, S., Shivalila, C. S., Dadon, D. B...30575746 Shalem, O., Sanjana, N. E., Hartenian, E., Shi, X., Scott, D. A., Mikkelsen, T. S., Heckl, D., Ebert...Reviews Genetics . 16 (5), 299–311. PMID: 25854182 Shi, J., Wang, E., Milazzo, J. P., Wang, Z., Kinney, ... Replogle, J. M., Adriaens, C., Ramadoss, G. N., Shi, Q., Hung, K. L., Samelson, A. J., Pogson, A. N.,...32203383 Nishimasu, H., Ran, F. A., Hsu, P. D., Konermann, S., Shehata, S. I., Dohmae, N., Ishitani, R., ... Cell , 46 (5), 595–605. PMID: 22521689 Yoshimi, K., & Mashimo, T. (2022). Genome editing technology and...

...23311447 Shalem, O., Sanjana, N. E., Hartenian, E., Shi, X., Scott, D. A., Mikkelsen, T. S., Heckl, D., Ebert...10.1126/science.1247005 PMID: 24336571 Shao, L., Shi, R., Zhao, Y., Liu, H., Lu, A., Ma, J., Cai, Y., ...

...PsChR1 Red-shifted chloride-conducting channel from Proteomonas sulcata 540 Phobos Blue-shifted iC++ variant...467 Aurora Red-shifted anion-selective ReaChR variant 517 Halorhodopsins Jaws Red-shifted, light-driven...kinetics: Examples: ChETA, C1V1(t/t), ChrimsonR Red-shifted peak action spectra Examples: VChR1, C1V1(t/t),...amplitude Examples: eNpHR, eNpHR2.0, eNpHR3.0 Red-shifted peak action spectra Example: Jaws Archaerhodopsins...K176R mutation. 590 PsChR2 High-efficiency blue-shifted channelrhodopsin from Platymonas subcordiformis...2014). Noninvasive optical inhibition with a red-shifted microbial rhodopsin. Nat Neurosci, 17 (8), 1123...O., Hegemann, P., & Deisseroth, K. (2008). Red-shifted optogenetic excitation: a tool for fast neural ...

...Genome Engineering, CRISPR, Mammalian Expression Takashi Yamamoto Plasmids for construction of all-in-one...TALEN Accessory Pack Genome Engineering, TALEN Takashi Yamamoto Nine pFUS array vectors and destination...Platinum Gate TALEN Kit Genome Engineering, TALEN Takashi Yamamoto Plasmids for construction of highly-active...

..., Ji, B., Takahashi, M., Huang, X. P., Slocum, S. T., DiBerto, J. F., Xiong, Y., Urushihata, T., Hirabayashi...

...mRNA due to alternative splicing, and an early frameshift mutation is more likely to result in a non-functional....org/10.1038/s41587-020-0490-7 PMID: 29305085 Hashimoto, M., & Takemoto, T. (2015). Electroporation enables...

...price, and other factors like availability and shipping time. Choose antibodies from companies that are...several to compare, or select one based on price, shipping availability, ease of purchase, or similar factors...

...EGFP Reverse EXFP-R GTCTTGTAGTTGCCGTCGTC For distinguishing EGFP vs ECFP vs EYFP Reverse F1ori-F GTGGACTCTTGTTCCAAACTGG...

...24533227 (Link opens in a new window) Watanabe, M., Nishikawaji, Y., Kawakami, H., & Kosai, K. I. (2021). Adenovirus...

...) PMID: 39322487 (Link opens in a new window) Matsushita, T., Okada, T., Inaba, T., Mizukami, H., Ozawa...