Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 10 results for: SHI

Showing: 1 - 10 of 10 results

  1. CRISPR Guide

    Type
    Guide
    ..., 156 (5), 935–949. PMID: 24529477 Nishimasu, H., Shi, X., Ishiguro, S., Gao, L., Hirano, S., Okazaki,...Wang, H., Yang, H., Shi, L., Katz, Y., Theunissen, T. W., Rangarajan, S., Shivalila, C. S., Dadon, D. B...30575746 Shalem, O., Sanjana, N. E., Hartenian, E., Shi, X., Scott, D. A., Mikkelsen, T. S., Heckl, D., Ebert...Reviews Genetics . 16 (5), 299–311. PMID: 25854182 Shi, J., Wang, E., Milazzo, J. P., Wang, Z., Kinney, ... Replogle, J. M., Adriaens, C., Ramadoss, G. N., Shi, Q., Hung, K. L., Samelson, A. J., Pogson, A. N.,...32203383 Nishimasu, H., Ran, F. A., Hsu, P. D., Konermann, S., Shehata, S. I., Dohmae, N., Ishitani, R., ... Cell , 46 (5), 595–605. PMID: 22521689 Yoshimi, K., & Mashimo, T. (2022). Genome editing technology and...

  2. Lentiviral Vector Guide

    Type
    Guide
    ...23311447 Shalem, O., Sanjana, N. E., Hartenian, E., Shi, X., Scott, D. A., Mikkelsen, T. S., Heckl, D., Ebert...10.1126/science.1247005 PMID: 24336571 Shao, L., Shi, R., Zhao, Y., Liu, H., Lu, A., Ma, J., Cai, Y., ...

  3. Optogenetics Guide

    Type
    Guide
    ...PsChR1 Red-shifted chloride-conducting channel from Proteomonas sulcata 540 Phobos Blue-shifted iC++ variant...467 Aurora Red-shifted anion-selective ReaChR variant 517 Halorhodopsins Jaws Red-shifted, light-driven...kinetics: Examples: ChETA, C1V1(t/t), ChrimsonR Red-shifted peak action spectra Examples: VChR1, C1V1(t/t),...amplitude Examples: eNpHR, eNpHR2.0, eNpHR3.0 Red-shifted peak action spectra Example: Jaws Browse Halorhodopsin...K176R mutation. 590 PsChR2 High-efficiency blue-shifted channelrhodopsin from Platymonas subcordiformis...2014. Noninvasive optical inhibition with a red-shifted microbial rhodopsin. Nat Neurosci. 17(8):1123-9... Yizhar O, Hegemann P, Deisseroth K. 2008. Red-shifted optogenetic excitation: a tool for fast neural ...

  4. Chemogenetics Guide

    Type
    Guide
    ... K, Ji B, Takahashi M, Huang X-P, Slocum ST, DiBerto JF, Xiong Y, Urushihata T, Hirabayashi T, Fujimoto..., Jin J (2015). The First Structure–Activity Relationship Studies for Designer Receptors Exclusively Activated...English JG, Liu J, Inoue K, Kumata K, Seki C, Ono M, Shimojo M, Zhang M-R, Tomita Y, Nakahara J, Suhara T, Takada...

  5. Plan Your Experiment

    Type
    Guide
    ...mRNA due to alternative splicing, and an early frameshift mutation is more likely to result in a non-functional....org/10.1038/s41587-020-0490-7 PMID: 29305085 Hashimoto, M., & Takemoto, T. (2015). Electroporation enables...

  6. Antibody Guide

    Type
    Guide
    ...price, and other factors like availability and shipping time. Choose antibodies from companies that are...several to compare, or select one based on price, shipping availability, ease of purchase, or similar factors...

  7. Sequencing Primers

    Type
    Guide
    ...-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP vs EYFP, reverse primer F1ori-...

  8. Adenovirus Guide

    Type
    Guide
    ...24533227 (Link opens in a new window) Watanabe, M., Nishikawaji, Y., Kawakami, H., & Kosai, K. I. (2021). Adenovirus...

  9. Molecular Biology Reference

    Type
    Guide
    ..., and thus the plasmid exists in a symbiotic relationship with the host cell. Like the bacterial chromosomal...
Showing: 1 - 10 of 10 results