We narrowed to 560 results for: cat.3

...VWR, EX0276-1 Benzonase 250 U/µl, Millipore #71205-3 Polybrene 10 mg/mL, Millipore, TR-1003-G Molecular...mL glutaGRO 50 U/mL benzonase: 15 mL DMEM Complete 3 µL of 250 U/µL benzonase Procedure Transducing Cells...0.03887375114 6.22E+06 2 400 768 18360 0.08366013072 6.69E+06 3 200 1620 15840 0.2045454545 8.18E+06 4 100 3180 20540... sample. This protocol was modified from the publication Wang et al. (2018) . Before Starting Thaw the...Scientific, 10199-452 Reagents GeneJet Genomic DNA Purification Kit, Thermo Fisher, K0721 6-well tissue culture...without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) Trypsin...FAM): tttggaatcacacgacct reverse primer: aatttctctgtcccactccatc PrimePCR ddPCR Copy Number Assay: RPP30...

...recipient plasmid to insert ratio of approximately 1:3. Since the number of base pairs for each varies, it...colonies and check them for successful ligations. Pick 3-10 colonies depending on the number of background ...vector by gel purification Run your digested DNA on an agarose gel and conduct a gel purification to isolate... not cut within your insert Are in the desired location in your recipient plasmid (usually in the Multiple...plasmids. Because you lose some DNA during the gel purification step, it is important to digest plenty of starting...prior to the ligation step or prior to the gel purification step, depending on the phosphatase you choose...isolate the DNA. When running a gel for purification purposes it is important to have nice crisp bands and...

...different buffers and do not use water). Microwave for 1-3 min until the agarose is completely dissolved (but...concentration of approximately 0.2-0.5 μg/mL (usually about 2-3 μl of lab stock solution per 100 mL gel). EtBr binds... length in base pairs) for visualization and purification. Electrophoresis uses an electrical field to...instructions on how to do this, visit the Gel Purification page. Tips and FAQ How do you get better resolution...

...should be ~60°C (between 50 and 65, with no more than 3 degrees between the two Tms)  Aim for 50-60% GC content...single peak, indicating one amplicon and no primer dimers. (b) A shoulder peak indicating primer dimers...Method Standard Curve?  Amplification Efficacy Calculation Amplification Efficacy Assumptions ...understanding and technical proficiency with common applications - now let’s dive right in! You know qPCR is...is most commonly used to measure relative quantification of mRNA, which can be used as a proxy measure...as it solves, so understanding and using the application correctly is imperative. Picking your chemistry... at least 25 bp away from each primer, ideally located close to either the forward or the reverse primer...

... expanded version by Nyla Naim was published Sept 3, 2020.   Scientists around the world have been making...light has limited applications in vivo. UV and blue light is readily absorbed and scattered by the skin, so...strategies Publication System nickname Photoactivatable moiety Cas9 variatn CRISPR protein application Split...improvements to CRISPR technology since its initial applications for genome engineering in 2012.  Many of these...scientists to use light to externally control the location, timing, and reversibility of the genome editing...enzymatic activity. Photoactivatable genome modifications by NHEJ and HDR using split systems Later in...mutations via NHEJ (frequency of 20.5%) and induced modifications by HDR (frequency of 7.2%). The authors additionally...

...70% ethanol TE buffer 3 M Na-acetate (pH 4.8) Protocol: Generalized DNA Purification Grow an overnight culture....5 volumes 95% or 100% ethanol and 1/10 volume of 3 M Na-acetate (pH 4.8). Invert the microfuge tube to... Agarose Gel Electrophoresis Agarose Gel DNA Purification Streaking and Isolating Bacteria Inoculating...instructions. If you want to perform plasmid purification without using a kit, you can find a protocol...using. Store DNA at 4°C. Tips and FAQ Plasmid purification kits provide the fastest way to obtain a high...

...or 1kb fragments are produced (see figure above). 3 Reasons The PSU Ladders Are Awesome Tools: They are... plasmid or group of plasmids' functions and applications. We hope that these articles make it easier ...FLIM (Fluorescence Lifetime Imaging Microscopy) applications. To demonstrate the power of mCyFP1, the Lin... Coselection efficiency is so high that some applications may permit working with edited “pools” of cells...showed high editing efficiencies with AsCpf1, indicating that ouabain coselection is a robust and flexible...be found at Addgene and in Figure S12 of the publication. Agudelo D, et al. Nature Methods. 2017. PubMed...potential of base editing for precise genome modification. Plasmid ID Plasmid Name Cas9 Variant Speacial...

...Timeline Day 1: Antigen Coating Day 2: Blocking Day 3: Primary antibody incubation Day 4: Secondary antibody...at room temperature or overnight at 4 °C . Section 3: Primary antibody incubation Carefully remove the ...Immunocytochemistry Protocol Recombinant Antibody Purification Protocol Antibody Guide Introduction This protocol...display a green product. A precipitated product indicates the presence of too much HRP and the need to optimize...

...a template. In general, edits must be downstream (3’) of the nick site, and guides that target closer ...control of gene repression and activation. Cell , 159 (3), 647–661. https://doi.org/10.1016/j.cell.2014.09.029...Achieving your desired edit comes down to location, location, location. Positioning your chosen Cas enzyme ...designing the gRNA component for each category. Genetic Manipulation Application Cas Enzyme Additional Considerations...the table below, we highlight the most common categories of genetic manipulations used in mammalian cells...gene you target will depend on your specific application. Knockout : Target constitutively expressed regions...start sites that could allow for expression of a truncated protein. Targeting an exon coding for an essential...

... the last section of the plate, to create streak #3. Incubate plate with newly plated bacteria overnight...plate to inoculate a bacterial culture for DNA purification will minimize the chance of having a mixture...

...Addgene's plasmid information pages recommend 5’ and 3’ sequencing primers. These primers typically anneal...Although your sequencing results may indicate bases at specific locations, by looking at the trace file, you...Diagnostic Restriction Digest Introduction Sequence verification of important plasmid features (such as the gene...file and use the search feature in the program to locate the incorrect sequence. Look at the peaks in the...after base 70 there are multiple peaks in the same location. Looking at the trace file will give you more...

...structures that promote primase-independent DNA replication. 3' ITR (RITR) in cis Right Inverted Terminal ... first- and third-generation rAdV vectors. Figure 3: Second-generation rAdV vectors. Created with BioRender.com... DNA replication and host cell manipulation. Late transcripts are expressed after DNA replication starts...production of replication-competent adenoviruses (RCAs) that would be able to infect cells and replicate autonomously..., which has limited their use in therapeutic applications. However, this has also made them the most widely...presence of adenoviral genes E1, E4, E2a and VA for replication. For more information about AAVs, read our AAV...whereas the E1 region is essential for viral replication and therefore needs to be supplied through other...

...Scientific, 10199-452 Ice bucket 96-well freezer blocks (x 3) Reagents Molecular Biology Grade Water, Hyclone, ...20X): 5 µL in 95 µL 1X PCR buffer (1:400) Dilution 3 (20X): 5 µL in 95 µL 1X PCR buffer (1:8,000) Dilution...post on ddPCR for AAV quantification. This protocol was modified from the publication Lock et al. (2014) ...

...are using disinfectants as described above in step 3. You will also need to maintain the appropriate water...bring your materials to a particular temperature, catalyze chemical reactions such as restriction digests...

...transformation tube by placing the bottom 1/2 to 2/3 of the tube into a 42°C water bath for 30-60 secs ...bacteria are used as the means for both storing and replicating plasmids. Because of this, nearly all plasmids...expression) carry both a bacterial origin of replication and an antibiotic resistance gene for use as ...bacteria. Scientists have made many genetic modifications to create bacterial strains that can be more...plasmid DNA for the purposes of storage and amplification. Higher efficiency cells are more important ...

.... Boil the samples for 10 min at 100 °C . Section 3: SDS-PAGE Prepare the precast gel as follows: Remove...Immunocytochemistry Protocol Recombinant Antibody Purification Protocol Introduction Western blot is a technique...lysis buffer will vary depending on the cellular location of the protein of interest. RIPA buffer is suitable...most proteins but more stringent buffers and a sonication step may be required for hard to extract proteins...BSA standard that range from 0–2000 µg/mL . In duplicate, dilute 10 µL of standard, blank, and lysate samples... nm . Calculate the average absorbance of the duplicate samples on the plate. Subtract the average absorbance...vary depending on the sample type and cellular location of the protein of interest. You may need to try...

...hand for 10 seconds. Incubate the sample(s) for 2-3 minutes on ice and centrifuge for 15 minutes at 12,000...You may also like... Kit-Free DNA Purification Agarose Gel Purification Molecular Biology Reference Introduction...information on nucleic acid quantification, see our protocol for DNA quantification , which can be modified... not affect the quality of RNA or downstream applications. To improve yield of RNA, instead of incubating...

...on plates without any antibiotic. Negative Result 3: Only the Non-resistant Strain Grows If only the non-resistant...Tetracycline 10 mg/mL 10 µg/mL Notes: Unless otherwise indicated, the antibiotic powder can be dissolved in dH ...test results. Sample Data In all cases below (-) indicates that the tested strain is not supposed to be resistant... resistant to the antibiotic, (+) indicates that the tested strain is supposed to be resistant to the ...

...stable cell pool were then expanded for an additional 3 weeks under blasticidin selection. Anti-Cas9 Western...without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) Trypsin...orange/yellow if using a standard phenol red pH indicator) because the buildup of waste products could be...

... a protein’s presence or absence. Figure 3: A western blot detecting proteins using the indirect detection...Handling Visualization Signal Amplification Application Overview Quantification Methods Capture Methods Visualization...Antibody Applications Antibody-based applications can be generally classed into four categories: Quantification... Read on to learn more about the applications common to each category, including an outline of the basic...these applications, visit the Antibody section of the Addgene Protocols page. Antibody Applications - Quantification...concentrates in the sample. Controls for quantification methods Quantification methods should be run with: a positive...using sonication to break DNA up into fragments of 300-1000 bps in length. Note: This sonication process...