We narrowed to 566 results for: PAC
-
TypeGuide...pBABE 5' CTTTATCCAGCCCTCAC (Weinberg Lab) Psi packaging signal, 5' of MCS in pBABE vectors, forward primer...CGCAACGATCTGGTAAACAC (Invitrogen) OpIE2 promoter, forward primer pACYC-F TGAAGTCAGCCCCATACGAT p15A origin, forward primer...
-
Modular Cloning Guide
TypeGuide...Naomi Nakayama A toolkit with both high cloning capacity and vector simplicity, compatible with other MoClo...between 12 and 31 repeats. Golden Gate TALEN Accessory Pack Genome Engineering, TALEN Takashi Yamamoto Nine ... -
Antibody Guide
TypeGuide...antibodies are collected, tested against the antigen, packaged, and sold. This is the most cost-efficient way...antibodies to upwards of twenty. Laser and software capacity theoretically allow for roughly fifty different... -
Science Guides
TypeGuide...Read More CRISPR Class 2 C lustered R egularly I nterspaced S hort P alindromic R epeat (CRISPR) systems,... -
Promoters
TypeGuide...Histones are proteins found in eukaryotic cells that package DNA into nucleosomes. Histone binding prevents ... -
Optogenetics Guide
TypeGuide...Description Peak Response Spectra (nm) BLUF domains bPAC Light-activated adenylyl cyclase from Beggiatoa ...