...if you obtained a transformant with a single insertion because it will segregate 3:1 in the T2 generation...lineage and has made countless transgenic plants in the process.     References 1. Emami, S., Yee, M. and Dinneny...Methods. BioMed Central, 2(1), p. 19. doi: 10.1186/1746-4811-2-19. PubMed PMID: 17087829. PubMed Central... which is ease of transformation. There are many motivations to generate transgenic Arabidopsis, from ...from studying transcriptional and translational dynamics of genes and proteins in living plants, to complementing... dip transformation method. The general steps for this method include: Cloning and transforming a plasmid...integrates transfer DNA (tDNA) into the genomes of the plants it attacks Growing the transformed agrobacterium...

...one of three different inherited genes: Presenilin 1, Presenilin 2, and APP gene.The majority (>90%) of...used to transform iPSCs and fibroblasts into neurons and more. New and Noteworthy: Study aberrant axon initial...associated with the disease and implicate a wide range of cellular processes. The vast majority of cases...kinetics and localization for imaging synaptic transmission. Aggarwal et al. Nat Methods. 2023 May 4. See...PiggyBac plasmids with tet-inducible expression of transcription factors for sensory, motor, and cortical neuron...Use a FRET-based method to monitor structural transitions in protein self-organization. Wan et al. Cell...

...focus on the AAV transfer plasmid and take a look at each of its parts. Figure 1: Parts of an AAV...human synapsin 1 promoter is neuronal specific (Haery et al., 2019). Most AAV transfer plasmids have a...repeats (ITRs) are what makes an AAV transfer plasmid an AAV transfer plasmid. ITR sequences are 145 bases...read through this challenging sequence. Transgene The transgene is the gene that will be delivered by the...control transgene expression. Lox sites are directional 34 bp sequences that can flank the transgene and ...(WHP) Posttranscriptional Regulatory Element (WPRE) forms a tertiary structure when transcribed which ... nuclear export of RNA and RNA translation, and promotes RNA transcript longevity. The polyA is located...

...Check out Addgene's New Viral Service! References 1. Hay, R.J., Macy, M.L. & Chen, T.R. “Mycoplasma infection...contaminations.” Methods in Molecular Biology 946 (2013). 1-13. Pubmed PMID: 23179822. 5. Segura, M.M., Kamen,...Production, concentration and titration of pseudotyped HIV-1-based lentiviral vectors."Nature protocols 4.4 (2009...may not translate well to other cell types. To overcome this issue, try transducing with a range of dilutions...DEAE-dextran can improve transduction efficiency. In addition, this study found that transduction efficiency...passage number of a culture the lower the transfection and transduction efficiencies. Cultures should only be...others opt for a single harvest after transfecting with the transfer and packaging plasmids. A benefit of...

...regulated in the medicinal plant, the Catharanthus roseus (Figure 1). The ultimate goal of our research ...reports 9.1 (1990): 1-5. PubMed PMID: 24226366. Lee, Min Woo, and Yinong Yang. "Transient expression assay... plant scientists do transient leaf transformations The development of transgenic plants is a common problem...that the transformation and gene expression can be tracked. During a transient leaf transformation, the engineered...method. Transfer your plant into the dark 16 hours before the transformation. We routinely transfer our plants...developing transgenic hairy root lines in tissue cultures takes half a year, and generating a transgenic plant...plant can take even longer, a transient plant leaf transformation process could save the plant biologist...

...glossary at the end of this post! Figure 1: Base transitions are edits between the purine bases (adenine...uracil DNA glycosylase. Nature Communications, 15(1), 4897. https://doi.org/10.1038/s41467-024-49343-5...uracil-DNA glycosylase. Nature Communications, 15(1), 6397. https://doi.org/10.1038/s41467-024-50012-w... the non-edited strand to encourage the cell to repair the DNA using the edited strand as a template —...editing. Like other transversion editors, this editor had relatively high indel rates ranging from 4.7% to 30%...our last post, we talked about the first base transversion editors: CGBEs, or C → G Base Editors. CGBEs...editor could excise other bases? Could other transversion editors be close at hand? Once again, this post...

...overcomes many of those limitations (Figure 1). Figure 1: Opto-katanin induces fast, localized microtubule...Signaling Toolbox. ACS Synthetic Biology, 11(1), 515–521. https://doi.org/10.1021/acssynbio.1c00604.  Mahlandt...specific area at the plasma membrane (Figure 2). Just express the plasma membrane-localized iLID along with...cell membrane isn’t powerful enough, what about altering the chemical composition of the membrane itself...SuperPLD hydrolyzes membrane PC to PA. A) OptoPLD is recruited to plasma membrane or lysosomes and its...optogenetic tools to control the cytoskeleton and cell membrane dynamics. First, a quick refresher.  The tools...undergoes a conformational change and binds the plasma membrane under blue light CRY2-CIB1 heterodimerizes or ...

...genome upon viral transduction. Many lentiviral transfer plasmids are based on the HIV-1 virus. For safety... the transfer plasmid must be modified. Most shRNA‐expressing lentiviral plasmids, such as pLKO.1, use...protocol for using the popular cloning vector pLKO.1. Trono Lab Resources: Lentivectors Toolbox and Maps...selection. Desfarges S, Ciuffi A. Viruses. 2010. Jan;2(1):111-30. PubMed . Altering the tropism of lentiviral...Curr Gene Ther. 2005. 5(4): 387-398. PubMed . HIV-1 Genome Nuclear Import Is Mediated by a Central DNA... can be used in transient transfections to achieve expression of the transgene, and those that can are.... Lentiviral transfer plasmids are not designed specifically for transient transfections. Therefore, there...

...whether they could 1) be decorated with proteins and remain functional, 2) break membranes outside of their...Follow her on Twitter @jessicapolka.     References 1. Kanabrocki, J. A., Quackenbush, R. L. & Pond, F. ...learn a lot from Nature’s simpler solutions to transmitting forces over long distances. For instance, how..., R bodies do not exert force by dynamically rearranging into different polymerization states. Instead...demonstrates that R bodies can function to break membranes of different organisms. And finally, we demonstrated...could use them to lyse cells (and surrounding membranes) in keeping with their natural function (see below...

...Communications , 15 (1), 3663. PMID: 38688943 Hsu, P. D., Scott, D. A., Weinstein, J. A., Ran, F. A., Konermann...pooled format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9..., 1163–1171. PMID: 23979020 Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P. D..., 17 (5), 471–479. PMID: 32203383 Nishimasu, H., Ran, F. A., Hsu, P. D., Konermann, S., Shehata, S. I....CRISPR-Cas9. Cell , 167 (7), 1829-1838.e9. PMID: 27984730 Ran, F. A., Hsu, P. D., Wright, J., Agarwala, V., Scott...Nature Protocols , 8 (11), 2281–2308. PMID: 24157548 Ran, F. A., Cong, L., Yan, W. X., Scott, D. A., Gootenberg...Communications , 14 (1), 6175. PMID: 37794046 Small precision edits Anzalone, A. V., Randolph, P. B., Davis,...

...plasma HIV-1, improving life expectancy and quality for HIV-1 patients. However, ART is not an HIV-1 cure. ...activated HIV-1, measured via HIV-1 promoter-driven GFP expression. In cell lines that can produce HIV-1 toxic...with HIV-1. For two HIV-1 strains, Cas9/gRNA lentiviral expression significantly reduced the HIV-1 copy number...HIV-1 transcription and destroy infected cells, the other using wild-type Cas9 to remove the HIV-1 genome...currently infected with the lentivirus HIV-1. Today, HIV-1 can be controlled with antiviral therapies ...take on HIV-1 in vitro, and what obstacles must be overcome for clinical success. ART and HIV-1 reservoirs...Cutting HIV-1 out of the genome with CRISPR/Cas9 Before the introduction of CRISPR, HIV-1 genome editing...

...PDF 2.3 MB Zhang GeCKO pooled library amplification 1 vector system: lentiCRISPR v2 2 vector system: lentiCas9...and Wente Zebrafish: gRNA cloning, in vitro transcription, injection gRNA core ; Cas9 ; optimized Cas9...102.5 KB Jaenisch CRISPR plasmid summary for transcriptional activation dCas9 activators sgRNA dual expression...

...Addgene, we use seven different types of “plates” (Fig. 1). When you have to tell an engineer that you want ...”? We took steps towards solving this problem by 1) making sure we qualified these words when we discussed...resources on the Addgene blog Read about other transferable skills Find all of our science career related...

...offers insight into a career as a Professor. Step 1: Your PI forwards you a Request For Applications (...proposal typically lists the deliverables, explains 1-2 potential pitfalls of the intended protocol, and...improve your grant writing skills. Good luck! Further advice on grant writing Since successful grant writing... during the grant application process. When my PhD advisor first asked me to write a grant application... advice on writing a grant proposal. "Murder Most Foul: How Not to Kill a Grant Application" by Vid Mohan-Ram...their advisor alone applies for these competitive grant applications; however, in some cases, your advisor...advisor may choose to allot some if not all grant duties to trusted students. For example, if the proposal...

... phototropin 1 LOVETRAP reversibly sequester and release proteins from cellular membranes using light....algae Chlamydomonas reinhardtii . Channelrhodopsin-1 (ChR1) is excited by blue light and permits nonspecific...concept of optogenetics. 2012 Prog Brain Res. 196: 1-28. PMID 22341318 Gradinaru V, Zhang F, Ramakrishnan...diversifying and extending optogenetics. Cell. 196:1-28. PMID 20303157 Han X, Boyden ES. 2007 Multiple-...Limitations and Future Developments. Exp Physiol. 96(1): 19–25. PMID 20621963 Mattis J, Tye KM, Ferenczi ...wavelengths, ranging from blue to yellow to red. Red light exhibits better tissue penetrance, which may ...including protein activation, membrane localization, and transcriptional activation. In the widely used...

...   Class 1 versus class 2 There are two CRISPR classes: Class 1 and Class 2. Class 1 CRISPR systems...archaea, though Class 1 remains largely underutilized compared to Class 2. Class 1 Despite their incredible...optimal plasmids to harness the power of Class 1 systems. Class 1 CRISPR systems can be further broken down...6105. https://doi.org/10.1093/nar/gku241 Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N....types, 33 subtypes, and 17 variants. Figure 1: Overview of the CRISPR classification hierarchy. ...effector complex after binding to a target. Class 1 is the most abundant of the two, comprising about ...incredible abundance, Class 1 CRISPR systems are less popular in the lab. This can be attributed to the multi-Cas...

...improve your grant writing and hopefully increase your success rate. 1. Submit your grant early! First...involved so it’s important not to throw in the towel if 1 or 2 funding bodies say no. If possible, get feedback...in writing small travel grants to attend conferences and a seed funding grant for a proof-of-principal...www.assaygenie.com. No matter what facet of academia you are in, grant writing can be the lynch pin that results in your...to be much use. 2. Originality is essential for grant success The two most important things reviewers ...sure that comes across. Check out some in-depth grant writing tips at the Human Frontier Science Program's...Skills 5. Practice makes perfect, apply for small grants too There are actually quite a lot of different...

...mediating the entry of SARS-CoV and SARS-CoV-2 viruses. ( 1 ) TMPRSS2 - a serine protease that primes the SARS-CoV... Plasmids expressing Cas12a/Cas13a, Reverse Transcriptases, etc. that may be useful for detection assays...site for furin proteases.( 3 ) BSG - (CD147), transmembrane glycoprotein of the immunoglobulin superfamily...proteolysis of SARS-CoV Spike protein, activating its membrane fusion function.( 5 ) TACE - (ADAM17) a metalloprotease... method termed DNA Endonuclease Targeted CRISPR Trans Reporter (DETECTR). Mammoth Biosciences has published...2020.06.23.166397 (Link opens in a new window) reverse transcriptase, protease, and Bst polymerase constructs now...unpublished) Taq polymerase and MMLV reverse transcriptase expression plasmids from the Drew Endy and Philippa...

...crevices proteins on the cell surface. Figure 1: Comparison of common antibody, HCab, and nanobody...Humana Press, pp 133–148. https://doi.org/10.1007/978-1-62703-293-3_10 Walter J et al. (2020) Synthetic nanobodies...sybodies against membrane proteins Developing antibodies against proteins embedded in membranes is tricky because...develop antibodies against unstable targets like membrane proteins that may unfold due to camelid high body...synthetic nanobodies, called sybodies, against membrane protein targets in as little as 3 weeks (Zimmermann...lab can quickly select for sybodies targeting a membrane protein of interest using the Sybody Generation...have a concave, loop, or convex scaffold and are randomized with a defined set of different trinucleotides...

...phosphorylated DNA termini to 3 ́-OH DNA termini (1-4). In vitro, ligases (notably T4 DNA ligase) are ... enzymology of DNA repair enzymes.     References 1. Shuman, Stewart, and Christopher D. Lima. "The polynucleotide...thermostable DNA ligase-encoding gene." Gene 109.1 (1991): 1-11. PubMed PMID: 1756968. 7. Lauer, G., et al. "Cloning...19329793. PubMed Central PMCID: PMC2719376. 5. Barany, Francis. "Genetic disease detection and DNA amplification...1986365. PubMed Central PMCID: PMC50775. 6. Barany, Francis, and David H. Gelfand. "Cloning, overexpression...Central PMCID: PMC208194. 8. Luo, Jianying, and Francis Barany. "Identification of essential residues in Thermus...(1989): 245-254. PubMed PMID: 2753355. 12. Barany, Francis. "The ligase chain reaction in a PCR world....

... CMV immediate early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter...end of LexA DNA binding domain, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer SP6 ATTTAGGTGACACTATAG SP6 promoter... CYC1 GCGTGAATGTAAGCGTGAC (Invitrogen) CYC1 transcription termination signal, reverse primer DsRed1-C ...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer pGP704-R AACAAGCCAGGGATGTAACG...primer Tn7-end GGGGTGGAAATGGAGTTTTT Bacterial transposon Tn7 TRC-F CAAGGCTGTTAGAGAGATAATTGGA (Root lab...

...expressing additional EBNA-1 transiently. The transiently expressed EBNA-1 increases protein expression...are based on the Epstein-Barr Nuclear Antigen-1 (oriP-EBNA-1) system where each vector contains a viral ...replication, OriP and the EBNA-1 sequence that encodes for the DNA binding protein EBNA-1 [7]. These two sequences...extra plasmid, pCXWB-EBNA-1 is used in the reprogramming cocktail. pCXWB-EBNA-1 lacks oriP and is unable...pCXLE vectors listed below in Table 1 are available at Addgene. Table 1: List of pCXLE episomal plasmids,... and shRNA against p53 pCXWB-EBNA1 37624 transient EBNA-1   Many thanks to our guest blogger, Kusumika...obtained and the subsequent reprogramming success [1]. Fibroblasts need to be cultured and expanded in ...

...between strand 10 and 11 to yield large (1-10) and small (11) fragments. In several cases an FP(1-10) fragment...General Design Figure 1: Two proteins are fused to the FP(11) and FP(1-10) fragments. When Protein...Description Article PI Blue EBFP2 EBFP2(1-10) and Capri(1-10) for use with GFP(11) Multiplexed labeling...Commun. 2017 Bo Huang mNeonGreen3 mNG3K(1-10) and mNG3A(1-10) for use with mNG2(11) Improved yellow-...sfCherry2 sfCherry2(1-10) and sfCherry2(11), also photo-activatable variant PAsfCherry2(1-10) Improved split...brings the pieces of the FP back together (Figure 1). This method is generally known as Bimolecular Fluorescence...even from a different base FP (for example, EBFP2(1-10) can be used with GFP(11)). Some of the articles...

...and placed in a buffer. Antibody Structure Figure 1: Structure of an antibody A standard antibody is made... together to form a “Y” shape, as shown in Figure 1. The two arms of the Y structure are responsible for...proteins by size. Transfer proteins from the gel to a membrane. Incubate the membrane with an unconjugated...block the membrane to remove excess antibody and prevent unwanted binding. Incubate the membrane with a ...Wash and block the membrane. Activate the HRP with a substrate kit. Image the membrane using either X-ray...hybridoma cells into plasmids. Plasmids are then transfected into cells and induced to express antibodies....variable regions, shown in light blue and light orange, that bind to a specific antigen, triggering an...

...sequences containing a G nucleotide at position 20 (1 bp upstream of the PAM) may be more efficacious than...population. Some cells may be wild type due to either (1) a lack of gRNA and/or Cas9 expression or (2) a lack... in vitro and in vivo. Nature Biotechnology . 33 (1), 73–80. PMID: 25357182...For easy-to-transfect cell types (e.g. HEK293 cells), transfection with standard transfection reagents may...mammalian cell line that can be transfected at high efficiency Lentiviral transduction Cas9 and gRNA can be present...present in a single lentiviral transfer vector or separate transfer vectors May contain reporter gene ...screens using CRISPR AAV transduction CRISPR elements are inserted into an AAV transfer vector and used to ...

...NLS-mRuby2 Control Gradinaru 83900 pAAV-mDlx-GFP-Fishell-1 Dlx GFP Control Fishell 83895 pAAV-hDlx-Flex-GFP-Fishell...this serotype to deliver Cre-dependent transgenes in Cre transgenic lines. As part of our standard viral...serotype permits robust retrograde access and transgene delivery to projection neurons. Specific classes...titering by SYBR green qPCR , confirmation of the transfer plasmid with PCR, purity assessment by silver ... viral prep format. Please note this does not guarantee viral vector packaging service, but lets us know...

...making it easier for us to do our work.” References 1. Athanasios Lampropoulos et al. "GreenGate - A Novel...terminators and resistance cassettes for selection of transgenic plants. The complete GreenGate toolkit, now available...the time required to generate multi-construct transgenic plants. In the most practical terms, what GreenGate...Versatile and Efficient Cloning System for Plant Transgenesis." PLoS ONE. 8(12): e83043 (20 December 2013)...

...just make their own buffers when the kits buffers ran out. Homemade buffers performed the same as those...series to increase binding capacity. Figure 1: Purify DNA using glass filters. Image: Kim and Morrison...a gravity-based column plasmid maxiprep kit takes 1-1.5 hours to complete, while this syringe-based method... solution. NaI has two purposes in this protocol: 1) it solubilizes both DNA and agarose, and 2) it helps...property and developed a protocol that uses Whatman No. 1 paper or even paper towels to purify DNA and RNA from...rather a glass powder slurry that has a milk-like appearance. To make DNA stick to the glass particles in ...the Patterson Protocol was shown to purify DNA ranging in size from 100 bp to 48 kb with high yields and...

...    Figure 1: A 1 mg/mL control is diluted in a series ranging from 1:2 to 1:32. Each individual...series that ranges from 1:2–1:32. The specific dilution series used will depend on the expected concentration...the data points fit the trendline. R2 ranges from 0 to 1 with 1 being a perfect fit and 0 indicating that...example, Figure 1 depicts a 2-fold dilution series. Each step of the series dilutes by 1:2 for a series...individual step of the series is consistent at 1:2. When preparing a dilution series, use a new pipette tip for...concentration lies within the dynamic range of the curve. The dynamic range is the linear span between the lowest...the dynamic range of your standard curve, so if your sample does not fall within this range, it may be ...

...cells transduced with lentiCas9-blast. A549 cells were transduced (MOI = 37) and selected with 1 µg/mL...expressing Cas9 via transduction with Cas9 lentiviral vector, lentiCas9-Blast (52962-LV, Figure 1). Some cells...were frozen down. Figure 1: Cas9 expression in A549 cells transduced with lentiCas9-blast. Anti-Cas9...of the gel in the BRAF gRNA-transduced samples (data not shown). Pro-Tips: 1.Designing primers against ...The entire process from start to finish took about 1 month. Cas9 delivery Overview: Before any editing...Western blotting is a loading control. Pro-Tips: 1. It’s all about the MOI. In retrospect I used a way... pool had wildly variable Cas9 expression (Figure 1). This is a problem because Cas9 expression affects...

...). Analysis of Transduction Efficiency, Tropism and Axonal Transport of AAV Serotypes 1, 2, 5, 6, 8 and...Overview. Cells, 12(5), 1–41. https://doi.org/10.3390/cells12050785 Murlidharan, G., Samulski, R. J., &... ONE, 9(8), 1–10. https://doi.org/10.1371/journal.pone.0106472 de Backer, M. W. A., Brans, M. A. D., Luijendijk...vector-mediated transduction of the corticospinal tract: Comparison of four promoters. Gene Therapy, 28(1–2), 56...the selection process. Factors to think about are (1) your experimental conditions and measurements; (2...serotype, promoter, and titer.     Figure 1: Flow chart depicting a) steps for selecting serotypes...injection site than AAV2 (Watakabe et al., 2015) (Figure 1). You’ll need to consider if such properties could...

... Table 1: Transduction efficiency of AAV-PHP.B versus AAV-PHP.eB in the CNS. A GFP transgene was packaged...marker). Check out tables 1 and 2 below for a summary of the quantified transduction efficiency of AAV-PHP.eB... AAV.PHP.S’s great neuronal transduction efficiency, as shown in tables 1 and 2, with a cell-type specific...nervous system (CNS). AAVs are popular tools because: 1) their genomes are easy to manipulate, 2) they have... AAV vectors. What can these AAV’s be used for?  1. Multi-color labeling of neurons Multi-color labeling... dendrites extend to. The keys to this method are 1) high levels of color diversity so that cells are ...expression into a two part system (figure 4d):  Part 1: A cocktail of three AAV vectors expressing RGB proteins...

...outside of the antibody’s dynamic range. Specifically, the 1:2, 1:1, and No dilution samples all have ...dilution range from 1:100–1:1,000. If your antibodies come from ascites fluid, try a dilution range from ...with a recommended dilution and/or range (typically between 1:500 and 1:10,000 for primary antibodies). ...from 1:1,000–1:100,000. Secondary antibodies For secondary antibodies, the recommended dilution range is ...is usually between 1:5,000 and 1:200,000. Check the manufacturer’s recommendations, and if needed, optimize...marked on the membrane (1) using the gel as a guide. The gel is then removed from the membrane (2) and the...Mark your membrane! Membranes look the same from both sides, so it’s quite easy to think lane 1 is‌ lane...

... assembly reaction** 1 5 min., 37 ºC (2.5 μl) 687 100% 274,200 2,742,000 1 60 min., 37 ºC (2.5 μl)... volume of the 1 ml outgrowth spread on each transformation plate can be manipulated to result in appropriate...Figure 3, Table 1). These improvements (5- to 12-fold increases in the number of transformants while maintaining...expected complete sequence for the lacI/lacZ genes (1), while sequencing of white colonies showed a mixture... obtained from 1-, 12- and 24-fragment assemblies of the lacI/lacZ cassette, and illustrates how the volume...fidelity studies conducted by Potapov et al. at NEB (1, 2). While T4 DNA Ligase, the mainstay of most biotechnological... 16 ºC) x 30 (100 μl) 78 90.7% 783 9,792 Table 1. Yields and fidelities for Golden Gate Assemblies ...

...recombineering system has three components (Figure 1): 1) Exo, 2) Beta, and 3) Gam. All three are required...generate 2 possible products: 1) a partially dsDNA duplex with single-stranded 3’ overhangs or 2) if the ...sequence of the translated protein.  These changes can be 5’ or 3’ of the desired change.   Table 1: Overview...recombineering with an ssDNA oligo substrate.   Figure 1: Components of the Lambda Red Recombineering system...and tags.  The typical frequency of recombinants is 1 positive clone out of 104 to 105 colonies. Pro Tip... with a recombination frequency between 0.1% to 1%, and can be increased to as high as 25-50% by designing...replication. There are two ways to avoid activating MMR: 1) use a strain of bacteria that has key MMR proteins...

...They help us to transform raw genomic coordinates into meaningful experiments. Table 1: An emerging family... chromosome, start, and stop. For instance (chr3, 1, 10) indicates a stretch of DNA at the very beginning...genetic elements like protein, RNA, and DNA (Table 1). As with GPS in the real world, coordinates alone...enhancers with the help of genome math. Figure 1: Genome math illustrated. Intersect (left) and set...histones with “GPS for proteins,” ChIP-seq from Table 1. Because of DNA’s 3D geometry and the chemical properties...experiment to identify the critical NANOG binding sites: 1. Find Enhancers that have NANOG binding sites 2. Design... In order to denote the NANOG enhancers from step 1 with genome math, we’ll need a bit of shorthand from...

...like uneven pipetting or irregular membrane transfer. Figure 1: A loading control is a type of positive...because the loading control band is weaker in condition 1 than condition 2, the normalized values for the two...to using loading controls accurately. Assumption #1: The loading control is not perturbed by the experiment...without your knowledge? If you can’t trust Assumption #1, any change in the normalized intensity of your POI...interest band is significantly lighter in “condition 1” than “condition 2.” By eye, the loading control appears... the protein abundance axis, both blue “condition 1” points (POI and loading control) are smaller than...assumptions discussed above into question. Assumption #1: The loading control is not perturbed by the experiment...

...Inactivation of AAV Serotype 1 Vectors. Human Gene Therapy Methods, 28(1), Article 1. https://doi.org/10.1089...commonly called “triple plasmid transfection” (Figure 1).    Figure 1: Overview of key steps of AAV production...repeat sequences. Human Gene Therapy Methods, 23(1), Article 1. https://doi.org/10.1089/hgtb.2011.034 Benyamini...in the CNS. Molecular Neurodegeneration, 15(1), Article 1. https://doi.org/10.1186/s13024-020-00361-z ..., expressing Ad E1A and E1B, can be transfected with your transfer plasmid, carrying your gene of interest... performed 12–18 hours post-transfection to help remove toxic transfection reagents and keep the cells...cells happy. Harvesting virus Once you have transfected your cells, wait 2–5 days and then collect the supernatant...

...loops 1 and 6 resulted in light controlled binding, but with opposite effects: insertion into loop 1 caused...experiments.  AsLOV2 Inertion Site mCherry #1 mCherry #2 GFP Loop 1 dark-induced dark-induced dark-induced...favorite protein (YFP). You have two options:  Option #1: Affinity tag purification You tag YFP and use an ...and one against GFP. Insertion of AsLOV2 into loop 1 always generated OptoNBs with dark-induced binding... induced dark-induced blue-light induced Table 1: Summary of the effect of AsLOV2 insertion site on...let the team detect its co-localization with a membrane-localized mCherry or GFP protein. With this system...bind, it co-localizes with its target at the cell membrane and when the OptoNB can’t bind, it localizes to...

...Table 1 below outlines a few of the more common genetic changes found in E. coli strains. Table 1: Common...amber (UAG) stop codon by tyrosine insertion λ-thi-1 or thi1 Mutation in thiamine metabolism Requires exogenous... all based on E. coli K-12 and are considered BSL-1. Table 2: Lab strains of E. coli Strain Natural...plasmids, blue/white screening. F- endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG Φ80dlacZΔM15 Δ(lacZYA-argF...) recA13 leuB6 ara-14 proA2 lacY1 galK2 xyl-5 mtl-1 rpsL20(SmR) glnV44 λ- JM109   General cloning and...strain for cloning repetitive DNA. endA1 glnV44 thi-1 relA1 gyrA96 recA1 mcrB+ Δ(lac-proAB) e14- [F' traD36...of an E. coli K-12 strain. F- λ- ilvG- rfb-50 rph-1 NEB Stable   For cloning into and storage of lentiviral...