Skip to main content
Addgene
Showing: 41 - 60 of 576 results
  1. Virus Protocol - Generating Stable Cell Lines

    Type
    Protocol
    ...cells for mycoplasma (Link opens in a new window) regularly Do not over or under-grow your cells. Thaw a new...selection. It is important to monitor these cells regularly and replace the cell media. Cell death by some... or removed from the culture, check the cells regularly to confirm transgene expression. As polyclonal..., consider generating monoclonal lines from the early polyclonal populations. Sample Data Figure 1: Generation...
  2. Water Bath Protocol

    Type
    Protocol
    ...properly maintain the water bath, empty and clean it regularly. Determine the amount of water needed to fill ...out after your incubation is over. Note: If you regularly use a water bath in the lab, you can leave the...previous uses. However, you will still need to regularly clean out the water bath even if you are using...
  3. Lab Safety for Biosafety Levels One and Two

    Type
    Protocol
    ... of the BSL-2 area. BSL-2 laboratories must be clearly marked as “BSL-2.” The names and contact information...information of the laboratory manager should be clearly visible in the room and on the door. BSL-2 centrifugation...
  4. AAV Purification by Iodixanol Gradient Ultracentrifugation

    Type
    Protocol
    ...genome-containing virions. Phenol red is added to clearly distinguish the steps. This method will help enrich...gradient before ultracentrifugation. The steps are clearly distinguishable thanks to the use of phenol red...
  5. Protocol - How to Run an Agarose Gel

    Type
    Protocol
    ...more quickly if you place the gel tray at 4 °C earlier so that it is already cold when the gel is poured...you get better separation of bands? If you have similarly sized bands that are running too close together...
  6. Plasmid Cloning by PCR (with Protocols)

    Type
    Protocol
    ... cloning is incredibly versatile and allows for nearly any piece of DNA to be placed into a backbone vector...complement to get PCR amplification. We can start similarly, taking the final 18bases of the ORF, including...
  7. Isolating a Monoclonal Cell Population by Limiting Dilution

    Type
    Protocol
    ...monoclonal cell lines from the polyclonal pool as early as possible, though in theory a monoclonal line ...empirically, and that the cell population be monitored regularly for transgene expression. This protocol has been...
  8. Adenovirus Guide

    Type
    Guide
    ...because the early genes necessary for replication have been deleted from the shuttle vector. Early gene E1...erminal r epeats (ITRs). Genes are divided into early (E1-4) and late (L1-5) transcripts. There are 57...crossover event between your adenoviral vector and the early genes found in the packaging cell lines creates ...
  9. Sequencing Primers

    Type
    Guide
    ...CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT...CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer CRE-R GCAAACGGACAGAAGCATTT...primer pLTet-F ACTGAGCACATCAGCAGGAC Lambda phage early leftward (pL) promoter, forward primer pLXSN 5' ...pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV major immediate-early protein (IE), forward primer pMT2-F TTGCCTTTCTCTCCACAGGT...
  10. CRISPR Guide

    Type
    Guide
    ...techniques are referred to as CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeat) technologies...AcrVA3.1, which inhibits both Cas12a and Cas3. Similarly, some Acr proteins are specific to a particular...editors are based on cytosine base editors and similarly work by first converting cytidine to uridine. ...with the sequence, so the edit is not considered “scarless”. Figure 7: Overview of CRISPR transposases Browse...by cutting only one strand CRISPR C lustered R egularly I nterspaced S hort P alindromic R epeat, a bacterial... Yang, L., Esvelt, K. M., Aach, J., Guell, M., DiCarlo, J. E., Norville, J. E., & Church, G. M. (2013)...
  11. Fluorescence Titering Assay

    Type
    Protocol
    ...cells for mycoplasma (Link opens in a new window) regularly Do not over- or under-grow your cells. Thaw a ...
  12. Gibson Assembly Protocol

    Type
    Protocol
    ...the important regions of your final plasmid, particularly the seams between the assembled parts. Tips ...
  13. Colony Formation Titering Assay

    Type
    Protocol
    ...cells for mycoplasma (Link opens in a new window) regularly Do not over or under-grow your cells. Thaw a new...
  14. Pipetting Protocol

    Type
    Protocol
    ...Introduction The pipette is an essential tool for nearly anyone in molecular biology. You’ll use a pipette...
  15. Chemogenetics Guide

    Type
    Guide
    ...Chemogenetics Guide Jump To: Chemogenetics Guide Early Chemogenetic Receptors: RASSLs DREADDs PSAMs LMOs...General overview of a chemogenetics experiment. Early Chemogenetic Receptors: RASSLs The first chemogenetic...
Showing: 41 - 60 of 576 results