Skip to main content
Addgene
Showing: 1 - 7 of 7 results

  1. Adenovirus Guide

    Type
    Guide
    ...because the early genes necessary for replication have been deleted from the shuttle vector. Early gene E1...erminal r epeats (ITRs). Genes are divided into early (E1-4) and late (L1-5) transcripts. There are 57...crossover event between your adenoviral vector and the early genes found in the packaging cell lines creates ...

  2. Sequencing Primers

    Type
    Guide
    ...CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT...CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer CRE-R GCAAACGGACAGAAGCATTT...primer pLTet-F ACTGAGCACATCAGCAGGAC Lambda phage early leftward (pL) promoter, forward primer pLXSN 5' ...pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV major immediate-early protein (IE), forward primer pMT2-F TTGCCTTTCTCTCCACAGGT...

  3. CRISPR Guide

    Type
    Guide
    ...techniques are referred to as CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeat) technologies...AcrVA3.1, which inhibits both Cas12a and Cas3. Similarly, some Acr proteins are specific to a particular...editors are based on cytosine base editors and similarly work by first converting cytidine to uridine. ...with the sequence, so the edit is not considered “scarless”. Figure 7: Overview of CRISPR transposases Browse...by cutting only one strand CRISPR C lustered R egularly I nterspaced S hort P alindromic R epeat, a bacterial... Yang, L., Esvelt, K. M., Aach, J., Guell, M., DiCarlo, J. E., Norville, J. E., & Church, G. M. (2013)...

  4. Chemogenetics Guide

    Type
    Guide
    ...Chemogenetics Guide Jump To: Chemogenetics Guide Early Chemogenetic Receptors: RASSLs DREADDs PSAMs LMOs...General overview of a chemogenetics experiment. Early Chemogenetic Receptors: RASSLs The first chemogenetic...

  5. Optogenetics Guide

    Type
    Guide
    ...and light oxygen voltage (LOV) domains function similarly to cryptochromes with light-induced changes in...Synthetic Neurobiology Group Optogenetics Resources Karl Deisseroth's Lab: Optogenetics Resource Center Boyden...

  6. Molecular Biology Reference

    Type
    Guide
    ...of phenotypic information was introduced in the early 19th century by Gregor Mendel, who later demonstrated...clones of the original cell. The plasmid DNA is similarly referred to as cloned DNA, and this process of...

  7. Science Guides

    Type
    Guide
    ...activity. Read More CRISPR Class 2 C lustered R egularly I nterspaced S hort P alindromic R epeat (CRISPR...
Showing: 1 - 7 of 7 results