Skip to main content
Addgene

We narrowed to 62 results for: c-Myc-promoter

Showing: 41 - 60 of 62 results
  1. Fluorescence Titering Assay

    Type
    Protocol
    ... glutaGRO. Store at 4 °C. Pro-Tip Different brands and lots of FBS can promote or inhibit transfection...it can be inactivated in the lab by heating to 56 °C for 30 min. Considerations Before You Start The health...obtaining accurate titers. Check the cells for mycoplasma (Link opens in a new window) regularly Do not... after 20–30 passages. Do not add penicillin/streptomycin to the media, as it can affect viability and...
  2. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...with pLKO.1 C. Cloning shRNA oligos into pLKO.1 C.1 Recommended materials C.2 Annealing oligos C.3 Digesting...Virus may be stored at 4°C for a few days, but should be frozen at -20°C or -80°C for long-term storage...., R is a purine (A,G), and Y is a pyrimidine (C,U). G-C content should be 36-52%. Sense 3’ end should ...annealed oligo from step C.2 20 ng digested pLKO.1 TRC-cloning vector from step C.3 (If you were unable ...Store at 4°C. m. Add 5 mL of fresh media containing antibiotics to the cells and incubate at 37°C, 5% CO ...at 37°C, 5% CO 2 overnight. Day 2: b. The target cells should be approximately 80-90% confluent. c. Dilute...solution is stable at 4°C for up to one year. The powder form of polybrene is stable at 4°C for several years...
  3. Plasmids 101: Modular Cloning Applications and Kits

    Type
    Blog Post
    ...researchers test many different combinations of promoters, terminators, solubility and purification tags...2016). The variety of constitutive and inducible promoters, linkers, and tags makes EcoFlex a great option...been used to examine the effects of different promoters, terminators, enhancers, and cross-cassette interactions... et al., 2019). Many plasmid elements such as promoters or fluorophores are interchangeable across organisms...doi.org/10.1371/journal.pone.0197185. Chamness, James C., et al. “An Extensible Vector Toolkit and Parts Library...Toolkit for Extensive and Flexible Engineering of Saccharomyces Cerevisiae.” ACS Synthetic Biology, vol. 12,...
  4. Virus Protocol - Generating Stable Cell Lines

    Type
    Protocol
    ...100X glutaGRO. Store at 4 °C. Pro-Tip Different brands and FBS lots can promote or inhibit transfection....it can be inactivated in the lab by heating to 56 °C for 30 min. Considerations Before You Start The health...dose of antibiotic, which may not be stable at 37 °C. To achieve a stable cell pool, the antibiotic selection...well plate and left undisturbed for 13 days. (a, b, c) Colonies formed by expansion of single cells for ...deliver mammalian antibiotic resistance (e.g., puromycin, blasticidin), which enables selection of a stable...preparation Appropriate antibiotic for selection (e.g. puromycin, blasticidin) Reagent Preparation DMEM Complete...obtaining accurate results. Check the cells for mycoplasma (Link opens in a new window) regularly Do not...
  5. Validated gRNA Sequences

    Type
    Collection
    ...CYC1m promoter S. cerevisiae CTAGATATTAAAATGTCTAA 64379 activate S. pyogenes 23977949 Lu CYC1m promoter S....Yamamoto avr-14 C. elegans GATTGGAGAGTTAGACCACG 58981 cut S. pyogenes 24879462 Mello avr-15 C. elegans GTTTGCAATATAAGTCACCC...Katic dpy-10 C. elegans GCTACCATAGGCACCACGAG 59933 cut S. pyogenes 25161212 Fire dpy-10 C. elegans TCCGCTACCATAGGCACCA...Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...Sabatini K08F4.2 C. elegans AATCACTCCCTGTTTGTGT 66085 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans CACGAGGTGGTATGCGCAG...Seydoux K08F4.2 C. elegans CGCAGCGGTTTCCAAAATG 66092 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans GCCTTAACCCAGAATAAGA...rde-1(D718) C. elegans TGCCATTAACTATGTATGT 59927 cut S. pyogenes 25161212 Fire rde-1(D801) C. elegans GATATTGTAGTCTATCGAGA...
  6. Colony Formation Titering Assay

    Type
    Protocol
    ... glutaGRO. Store at 4 °C. Pro-Tip Different brands and lots of FBS can promote or inhibit transfection...it can be inactivated in the lab by heating to 56 °C for 30 min. Considerations Before You Start The health...obtaining accurate titers. Check the cells for mycoplasma (Link opens in a new window) regularly Do not... after 20–30 passages. Do not add penicillin/streptomycin to the media, as it can affect viability and... . The following day, cells were treated with puromycin. Colonies were allowed to grow in the presence...
  7. Sequencing Primers

    Type
    Guide
    ...vectors with AOX1 promoter, forward primer 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter, forward primer...metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter, forward primer Myc GCATCAATGCAGAAGCTGATCTCA... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward...ATTTAGGTGACACTATAG SP6 promoter, forward primer T3 GCAATTAACCCTCACTAAAGG T3 promoter, forward primer T7 TAATACGACTCACTATAGGG...Human U6 promoter, forward primer LNCX AGCTCGTTTAGTGAACCGTCAGATC (BD Biosciences) Human CMV promoter, forward...pombe nmt1 promoter, forward primer OpIE2 Forward CGCAACGATCTGGTAAACAC (Invitrogen) OpIE2 promoter, forward...baculovirus vector with polyhedrin promoter, reverse primer pQE promoter CCCGAAAAGTGCCACCTG (Qiagen) 5' of...
  8. CRISPR Plasmids - Bacteria

    Type
    Collection
    ... to create A->G (or T->C on the opposite strand) mutations. ID Plasmid Promoter PI Publication Nick CRISPR...lower efficiency than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Browse CRISPR Plasmids By Function...-directed repair (HDR). ID Plasmid Gene/Insert Promoter PI Publication Prime Edit Cas9 H840A nickase fused...edits on an RT template. ID Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest...to your specific locus. ID Plasmid Gene/Insert Promoter PI Publication Interfere Catalytically dead dCas9...Design your gRNA to target your gene of interest’s promoter/enhancer or the beginning of the coding sequence...
  9. Tips for arabidopsis transformation

    Type
    Blog Post
    ...gateway vectors and can be used for promoter swapping and generating N and C terminally tagged fusion proteins... plant selection markers (basta, hygromycin, kananamycin, tunicamycin) (Nakagawa et al., 2007). Alternatively...
  10. CRISPR Plasmids - Plants

    Type
    Collection
    ...create A->G (or T->C on the opposite strand) mutations. ID Plasmid Gene/Insert Promoter Selectable Marker...-directed repair (HDR). ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Prime Edit Cas9...edits on an RT template. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Activate Catalytically...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest...to your specific locus. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Interfere Catalytically...Design your gRNA to target your gene of interest’s promoter/enhancer or the beginning of the coding sequence...to your specific locus. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Empty gRNA Expression...
  11. Fluorescent Proteins 101: Monitoring Cell Mobility Using Fluorescent Proteins

    Type
    Blog Post
    ...microscope and GFP fusion proteins controlled by promoters specific to the immune lineage, scientists could...Finsterbusch, Michaela, et al. "Patrolling monocytes promote intravascular neutrophil activation and glomerular...system and its dynamics. References 1. Peters, Nathan C., et al. "In vivo imaging reveals an essential role...during the development and disintegration of mycobacterial granulomas." Immunity 28.2 (2008): 271-284. ...presentation and T cell effector function in mycobacterial granulomas." Immunity 34.5 (2011): 807-819. ...
  12. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...Gene/Insert Promoter Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter Selectable...Gene/Insert Promoter Selectable Marker PI Publication Drosophila ID Plasmid Gene/Insert Promoter Selectable...find a gRNA vector based on expression system, promoter, the type of gRNA (e.g., pegRNA, epegRNA, nicking...plasmid contains Cas9. ID Plasmid Expression System Promoter Guide RNA Type Cloning Enzyme Co-expressed Cas9...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...which a reverse transcriptase (RT) is fused to the C terminus of Cas9 H840A nickase. The fusion enzyme ...-Puro Mammalian, piggyBac hU6 pegRNA BsmBI No Puromycin Jacob Giehm Mikkelsen 173222 pPBT-PE2-PuroTK-pegRNA_GG...
  13. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...inactive N- and C-terminal fragments and placed under the control of different promoters. Expression of... of choice, promoter, or search by inducible system (e.g., search for "split", "rapamycin", “tamoxifen...specific times or locations using cell-specific promoters or inducible systems, you can precisely control... lox-STOP-lox shRNA constructs, Cre expression promotes shRNA expression. Gene Switch: These constructs...Recombinase Plasmids ID Plasmid Description Vector Type Promoter PI Additional Addgene resources Explore our full...Recombinase Plasmids ID Plasmid Description Vector Type Promoter PI Additional Addgene resources Search our full...
  14. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...sgRNA with U6 promoter 48962 Worm HindIII none S. pyogenes de Bono sgRNA with rpr-1 promoter 48961 Worm ...of two sgRNAs from independent U6 promoters and Cas9 from CBh promoter. Ventura A CRISPR/Cas9 toolkit for...Cas9 + Empty sgRNA) 47549 C. elegans yes, cut S. pyogenes Goldstein DR274 42250 C. elegans BsaI none S. pyogenes...along with 1-4 sgRNAs expressed from independent promoters. sgRNAs are cloned into separate vectors and then... assembly of single gRNA vectors with various promoters, plasmids for assembling multiple gRNAs into one...pGGDestTol2LC vector. Uses five distinct zebrafish U6 promoters for sgRNA expression. Chen pCFD4-U6:1_U6:3tandemgRNAs...expression of two gRNAs from Drosophila U6:1 and U6:3 promoters. Bullock pCFD5 Drosophila Utilizes endogenous ...
  15. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...: 95 °C for 15 min, 35 cycles of (95 °C for 30 sec, 60 °C for 1 min, 72 °C for 1 min), and 72 °C for 10...following parameters: 37 °C for 30 min; 95 °C for 5 min and then ramp down to 25 °C at 5 °C/min. Dilute oligos...parameters: Cycles 1-20 (37 °C for 5 min, 20 °C for 5 min); Cycle 21 (80 °C for 20 min). These cycling ...Incubate at 30 - 37 °C for 24 - 72 hr. 30 °C may enhance genome editing efficiency, but 37 °C is acceptable....cells to incubate at 37 °C for 3 - 7 days and allow the clones to incubate at 37 °C for 7 - 14 days. Vary...thermocycler and run the following program: 65 °C for 6 min, 98 °C for 2 min to extract gDNA. Measure the DNA...clones. Run sample in thermocycler: 65 °C for 6 min and 98 °C for 2 min to extract gDNA. Screen each clone...
  16. What's Your Organism? Expanding Genomic Tools via the NSF EDGE Program

    Type
    Blog Post
    ...beneficial for many systems. How the EDGE Program promotes scientific sharing The EDGE Program is designed...habitats - even 50 meters from Old Faithful in 60 °C soils. Dendrobatidae (Lauren O’Connell)  Poison frogs...So, think beyond Drosophila melanogaster or Saccharomyces cerevisiae (both fine research organisms) -  ...
  17. CRISPR Plasmids - Drosophila

    Type
    Collection
    ...lower efficiency than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Nick CRISPR/Cas nickase mutants...-directed repair (HDR). ID Plasmid Gene/Insert Promoter PI Publication Prime Edit Cas9 H840A nickase fused...edits on an RT template. ID Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest...to your specific locus. ID Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors Select...variety of Cas-containing plasmids. ID gRNA Plasmid Promoter Cloning Enzyme(s) Delivery Resistance Co-expressed...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...
  18. mTOR Pathway

    Type
    Collection
    ...anabolic to catabolic processes. Active mTORC1 promotes protein and lipid synthesis, and increases energy... cancer. Loss of the tumor suppressor p53 also promotes aberrant mTORC1 activity, and multiple familial...mTORC1. The hyperactivation of mTORC1 in cancer promotes the conditions needed for uncontrolled cell growth... which appears to signal upstream of Akt, also promotes cell survival and proliferation. mTOR Pathway ...PKC eta PKC iota PKC theta PKC zeta Protein kinase C Protor Also known as PRR5; proline rich 5 PTEN Phosphatase...Resources The m echanistic or m ammalian t arget o f r apamycin (mTOR) is a key metabolic regulator controlling...threonine kinase 11 mTOR Mechanistic target of rapamycin NF1 Neurofibromin 1 PRAS40 Also known as AKT1S1...
  19. Molecular Biology Reference

    Type
    Guide
    ... T H A, C, or T K G or T M A or C N A, T, C, or G R A or G S C or G V A, C, or G W A or T Y C or T Amino...human cells, the promoter will be a human or mammalian promoter sequence. The promoter can also direct ...tissue-specific promoter (e.g., a liver-specific promoter). The strength of the promoter is also important...particular plasmid. Promoter Region Drives transcription of the insert. The promoter is designed to recruit...expression (i.e., a strong promoter directs high expression, whereas weaker promoters can direct low/endogenous...information about promoters, both bacterial and eukaryotic, as well as common promoters used in research...contain a promoter sequence, a transcription terminator sequence, and the inserted gene. The promoter region...
  20. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...sequence (PFS). In bacteria, Cas13 targeting also promotes non-specific RNA cleavage, but this non-specific... Streptococcus , Streptomyces , and others) Drosophila Plants (monocots and dicots) C. elegans Yeast (...Zebrafish Xenopus References Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, Moineau S, Romero...23287718 Dalvai M, Loehr J, Jacquet K, Huard CC, Roques C, Herst P, Côté J, Doyon Y. 2015. A Scalable Genome-Editing-Based...Adamson B, Villalta JE, Chen Y, Whitehead EH, Guimaraes C, Panning B, Ploegh HL, Bassik MC, Qi LS, Kampmann ...
Showing: 41 - 60 of 62 results