We narrowed to 57 results for: c-Myc-promoter

... glutaGRO. Store at 4 °C. Pro-Tip Different brands and lots of FBS can promote or inhibit transfection...it can be inactivated in the lab by heating to 56 °C for 30 min. Considerations Before You Start The health...obtaining accurate titers. Check the cells for mycoplasma (Link opens in a new window) regularly Do not... after 20–30 passages. Do not add penicillin/streptomycin to the media, as it can affect viability and...

...with pLKO.1 C. Cloning shRNA oligos into pLKO.1 C.1 Recommended materials C.2 Annealing oligos C.3 Digesting...Virus may be stored at 4°C for a few days, but should be frozen at -20°C or -80°C for long-term storage...., R is a purine (A,G), and Y is a pyrimidine (C,U). G-C content should be 36-52%. Sense 3’ end should ...annealed oligo from step C.2 20 ng digested pLKO.1 TRC-cloning vector from step C.3 (If you were unable ...Store at 4°C. m. Add 5 mL of fresh media containing antibiotics to the cells and incubate at 37°C, 5% CO ...at 37°C, 5% CO 2 overnight. Day 2: b. The target cells should be approximately 80-90% confluent. c. Dilute...solution is stable at 4°C for up to one year. The powder form of polybrene is stable at 4°C for several years...

...inactive N- and C-terminal fragments and placed under the control of different promoters. Expression of... of choice, promoter, or search by inducible system (e.g., search for "split", "rapamycin", “tamoxifen...specific times or locations using cell-specific promoters or inducible systems, you can precisely control... lox-STOP-lox shRNA constructs, Cre expression promotes shRNA expression. Gene Switch: These constructs...Recombinase Plasmids ID Plasmid Description Vector Type Promoter PI Additional Addgene resources Explore our full...Recombinase Plasmids ID Plasmid Description Vector Type Promoter PI Additional Addgene resources Search our full...

...researchers test many different combinations of promoters, terminators, solubility and purification tags...2016). The variety of constitutive and inducible promoters, linkers, and tags makes EcoFlex a great option...been used to examine the effects of different promoters, terminators, enhancers, and cross-cassette interactions... et al., 2019). Many plasmid elements such as promoters or fluorophores are interchangeable across organisms...doi.org/10.1371/journal.pone.0197185. Chamness, James C., et al. “An Extensible Vector Toolkit and Parts Library...Toolkit for Extensive and Flexible Engineering of Saccharomyces Cerevisiae.” ACS Synthetic Biology, vol. 12,...

...100X glutaGRO. Store at 4 °C. Pro-Tip Different brands and FBS lots can promote or inhibit transfection....it can be inactivated in the lab by heating to 56 °C for 30 min. Considerations Before You Start The health...dose of antibiotic, which may not be stable at 37 °C. To achieve a stable cell pool, the antibiotic selection...well plate and left undisturbed for 13 days. (a, b, c) Colonies formed by expansion of single cells for ...deliver mammalian antibiotic resistance (e.g., puromycin, blasticidin), which enables selection of a stable...preparation Appropriate antibiotic for selection (e.g. puromycin, blasticidin) Reagent Preparation DMEM Complete...obtaining accurate results. Check the cells for mycoplasma (Link opens in a new window) regularly Do not...

...vectors with AOX1 promoter Forward 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter Forward AC5 ACACAAAGCCGCTCCATCAG...metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter Forward Myc GCATCAATGCAGAAGCTGATCTCA...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter Forward IRES-F...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward M13 Forward...araBAD promoter Forward pBAD Reverse GATTTAATCTGTATCAGG For vectors with E. coli araBAD promoter Reverse... ATTTAGGTGACACTATAG SP6 promoter Forward T3 GCAATTAACCCTCACTAAAGG T3 promoter Forward T7 TAATACGACTCACTATAGGG... AUG1 promoter Forward AUG1 Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1 promoter Reverse...

... glutaGRO. Store at 4 °C. Pro-Tip Different brands and lots of FBS can promote or inhibit transfection...it can be inactivated in the lab by heating to 56 °C for 30 min. Considerations Before You Start The health...obtaining accurate titers. Check the cells for mycoplasma (Link opens in a new window) regularly Do not... after 20–30 passages. Do not add penicillin/streptomycin to the media, as it can affect viability and... . The following day, cells were treated with puromycin. Colonies were allowed to grow in the presence...

...plasmid (Loqué et al., 2007) containing the PMA1 promoter and the URA3 marker, the p415 plasmid (Loqué et... et al., 2007) containing the TEF1 promoter and the LEU2 marker, or the pCEV-G2-Km plasmid (Vickers et...et al., 2013) containing the TEF1 or PGK1 promoters and the KanMX marker. ID Plasmid Gene/Insert Selectable...PMID: 15197731 (Link opens in a new window) Vickers, C. E., Bydder, S. F., Zhou, Y., Nielsen, L. K. (2013...cassettes for fluorescent protein tagging in Saccharomyces cerevisiae. Yeast, 21 (8):661-70. https://doi.org...antibiotic selection markers for engineering in Saccharomyces cerevisiae. Microb Cell Fact, 12 :96. https:...

...anabolic to catabolic processes. Active mTORC1 promotes protein and lipid synthesis, and increases energy... cancer. Loss of the tumor suppressor p53 also promotes aberrant mTORC1 activity, and multiple familial...mTORC1. The hyperactivation of mTORC1 in cancer promotes the conditions needed for uncontrolled cell growth... which appears to signal upstream of Akt, also promotes cell survival and proliferation. mTOR Pathway ...PKC eta PKC iota PKC theta PKC zeta Protein kinase C Protor Also known as PRR5; proline rich 5 PTEN Phosphatase...Resources The m echanistic or m ammalian t arget o f r apamycin (mTOR) is a key metabolic regulator controlling...threonine kinase 11 mTOR Mechanistic target of rapamycin NF1 Neurofibromin 1 PRAS40 Also known as AKT1S1...

...gateway vectors and can be used for promoter swapping and generating N and C terminally tagged fusion proteins... plant selection markers (basta, hygromycin, kananamycin, tunicamycin) (Nakagawa et al., 2007). Alternatively...

...Insert Promoter Selectable Marker PI Publication Return to top Plant ID Plasmid Gene/Insert Promoter Selectable...CRISPR Guide . Mammalian ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Return to top...top Bacteria ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Return to top Drosophila ...find a gRNA vector based on expression system, promoter, the type of gRNA (e.g., pegRNA, epegRNA, nicking...plasmid contains Cas9. ID Plasmid Expression System Promoter Guide RNA Type Cloning Enzyme Co-expressed Cas9...which a reverse transcriptase (RT) is fused to the C terminus of Cas9 H840A nickase. The fusion enzyme ...-Puro Mammalian, piggyBac hU6 pegRNA BsmBI No Puromycin Jacob Giehm Mikkelsen 173222 pPBT-PE2-PuroTK-pegRNA_GG...

...microscope and GFP fusion proteins controlled by promoters specific to the immune lineage, scientists could...Finsterbusch, Michaela, et al. "Patrolling monocytes promote intravascular neutrophil activation and glomerular...system and its dynamics. References 1. Peters, Nathan C., et al. "In vivo imaging reveals an essential role...during the development and disintegration of mycobacterial granulomas." Immunity 28.2 (2008): 271-284. ...presentation and T cell effector function in mycobacterial granulomas." Immunity 34.5 (2011): 807-819. ...

...beneficial for many systems. How the EDGE Program promotes scientific sharing The EDGE Program is designed...habitats - even 50 meters from Old Faithful in 60 °C soils. Dendrobatidae (Lauren O’Connell)  Poison frogs...So, think beyond Drosophila melanogaster or Saccharomyces cerevisiae (both fine research organisms) -  ...

...sequence (PFS). In bacteria, Cas13 targeting also promotes non-specific RNA cleavage, but this non-specific... Streptococcus , Streptomyces , and others) Drosophila Plants (monocots and dicots) C. elegans Yeast (...Zebrafish Xenopus References Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, Moineau S, Romero...23287718 Dalvai M, Loehr J, Jacquet K, Huard CC, Roques C, Herst P, Côté J, Doyon Y. 2015. A Scalable Genome-Editing-Based...Adamson B, Villalta JE, Chen Y, Whitehead EH, Guimaraes C, Panning B, Ploegh HL, Bassik MC, Qi LS, Kampmann ...

... T H A, C, or T K G or T M A or C N A, T, C, or G R A or G S C or G V A, C, or G W A or T Y C or T Amino...downstream from a promoter to drive expression of the inserted gene. Insert The gene, promoter, or other DNA...particular plasmid. Promoter Region Drives transcription of the insert. The promoter recruits transcriptional...strength of the promoter can control the level of insert expression, as a strong promoter directs high expression...weaker promoters can direct low/endogenous expression levels. For more information about promoters, check...Thymine (T), Cytosine (C) and Guanine (G). In the double helix, A always pairs with T and C always pairs with...Adenine C Cytosine G Guanine T Thymine U Uracil Single Letter Code: Ambiguous bases Nucleobase B C, G, or...

...LTR for self-inactivation LTR Viral Promoter Wildtype Hybrid promoter; 5' LTR is partially deleted and fused...with a heterologous promoter (CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter; the transcript begins.... M., Chen, I. S., Hahn, W. C., Sharp, P. A., Weinberg, R. A., & Novina, C. D. (2003). Lentivirus-delivered...plasmids include tat , as the 5’ LTR is used as a promoter on the transfer plasmid, and this requires Tat...contains a chimeric 5’ LTR fused to a heterologous promoter (often CMV or RSV), eliminating the need for transactivation... fused to a heterologous enhancer/promoter such as CMV or RSV Table 1. Summary of key differences between...cell lines, VSV-G is often put under an inducible promoter. Depending on the cell type, there are other envelope...

...heterologous promoter (usually CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter; the transcript... to prefer transcription start sites, such as promoters and enhancers. Many times, integration sites are...cell lines, VSV-G is often put under an inducible promoter. Depending on the cell type, there are other envelope...selection is driven by strong enhancers and active promoters. Nucleic Acids Research , 42 (7), 4257–4269. https...plasmids use a hybrid 5' LTR with a constitutive promoter such as CMV or RSV. 3' LTR in cis Terminates transcription...Wong, G. K., Cameron, E. R., Kilbey, A., & Neil, J. C. (2016). Gamma-Retrovirus integration marks cell Type-Specific...10.1371/journal.pone.0154070 PMID: 27097319 LaFave, M. C., Varshney, G. K., Gildea, D. E., Wolfsberg, T. G....