... C-terminal 3xHA tag for yeast expression Myc Epitope Tag pKMyc - N-terminal Myc ...#834 - C-terminal GST for C elegans expression GFP Localization pcDNA3-EGFP - C-terminal...plasmid with a promoter that will be functional in your host organism. Host Relevant Promoters Representative... from the SP6 promoter pCS2 mt-GFP - Create myc-tag, GFP-tag fusions for transcription...expression 6xHis Epitope Tag pEZYmyc-His - C-terminal Myc-His tag for mammalian expression...vector (PGK1 promoter, 2μ) pXP316 - Yeast expression vector (TEF1 promoter, CEN/ARS) pAG304GAL-ccdB...vector (PGK1 promoter, CEN/ARS) pXP222 - Yeast expression vector (PGK1 promoter, 2μ) pAG305GAL-ccdB...

...Klf4, Myc, and Brd3R from five separate lentiviral plasmids The acetyllysine reader BRD3R promotes human...state using a cocktail of factors (Oct3/4, Sox2, c-Myc, and Klf4) that are known to maintain pluripotency...Doxycycline-inducible expression of human Oct4, Sox2, Klf4, and c-Myc from four separate lentiviral plasmids A drug-inducible...for the expression of human Oct4, Klf4, Sox2, and c-Myc Human Induced Pluripotent Stem Cells Produced Under... vector for the expression of human Oct4, Klf4, c-Myc, and Sox2 Integrative Analyses of Human Reprogramming...Lentivirus Human Expression of human Klf4, Oct4, c-Myc, and Sox2 as VP-16 transcriptional activating fusions...polycistronic expression of human Oct4, Klf4, Sox2, c-Myc and hairpin RNA p53 for single plasmid reprogramming...

...including transcriptional reporters for NF-kb, TGF-b, c-Myc, p53 and MAPK/JNK transcriptional reporters Koen...investigate the effect of regulatory elements, such as promoters, enhancers and untranslated regions, or the effect...available that are driven by a strong constitutive promoter and can be used to monitor transfection or viral...plasmids by using the bacterial ORI as the core promoter, which was a source of false positives with the...Description PI 16539 pBV-Luc Firefly Insertion of 5' promoter/enhancer regions Bert Vogelstein 12178 pIS0 Firefly... Renilla luciferase under the control of a CMV promoter is present for normalization William Kaelin 71248...71248 pXPG Firefly Insertion of 5' promoter/enhancer regions. Mutations within the luciferase gene allow...

...pCMVTNT PINK1 N-myc PINK1 Myc CMV Parkinson's Mark Cookson 13314 pCMVTNT PINK1 C-myc PINK1 Myc CMV Parkinson's...Ultra-Exon1Q23-Myc-A HTT Myc UbC Huntington's Baoji Xu 110487 Ultra-Exon1Q145-Myc-A HTT Myc UbC Huntington's...pUltra-Exon1Q23-Myc-B HTT Myc UbC Huntington's Baoji Xu 110489 pUltra-Exon1Q145-Myc-B HTT Myc UbC Huntington's...Strep-Lrrk2-Myc LRRK2 Myc, Strep CMV Parkinson's Maik Hintze 161583 pPuro3.1(+)_Strep-Lrrk2-Myc LRRK2 Myc, Strep...LRRK2-WT LRRK2 His, Myc CMV Parkinson's Ted Dawson 17612 pRK5-Myc-Parkin PRKN Myc CMV Parkinson's Ted ... pGW1-Myc-DJ1-WT PARK7 V5 CMV Parkinson's Mark Cookson 29349 pGW1-Myc-DJ1-L166P/K130R PARK7 Myc CMV Parkinson's...D1994S)-Myc LRRK2 Myc, Strep CMV Parkinson's Maik Hintze 161585 pPuro3.1(+)_Strep-Lrrk2(G2019S)-Myc LRRK2...

...system is tight temporal regulation. Promoter-regulated Cre: The promoter region defines the areas in which...active promoter like CAG, or expressed only in a subset of cells under a more specific promoter (e.g. ...HIV-TAT - promotes cellular uptake of recombinant Cre Bacterial Rajewsky 13775 pCAG-Cre Cre-Myc CAG Mammalian...Cepko 13779 pRho-Cre Cre-Myc rhodopsin Mammalian Cepko 13780 pNrl-Cre Cre-Myc, Expressed in rod photorecetor... PBAD promoter Bacterial Richmond 112614 pVHC Venus and Cre-ERT2 with MCS for inserting promoter none ...inserting promoter none Mammalian Heller 112616 pmTHC TFP and Cre-ERT2 with MCS for inserting promoter none...respectively) and placed under the control of different promoters. Expression of both N and CCre in the same cell...

...inducible promoters capable of controlling eukaryotic gene expression. Several endogenous promoters had been...Tetracycline-dependent promoters are developed by placing a TRE upstream of a minimal promoter. Tetracycline Off....CMV.tTA Adenoviral; CMV promoter; see article for neuronal-specific promoter and enhancer options tTA...for Tet transregulators. Krueger C, Pfleiderer K, Hillen W, Berens C. Biotechniques . 2004 Oct;37(4):546... tetracycline, expression from a tet-inducible promoter is reduced. To use tetracycline as a regulator...these tetO sequences and the activation domain promotes expression. In the presence of tetracycline, tetracycline...are: Plasmid containing a tetracycline-dependent promoter upstream of your gene of interest tTA expression...

...CYC1m promoter S. cerevisiae CTAGATATTAAAATGTCTAA 64379 activate S. pyogenes 23977949 Lu CYC1m promoter S....Yamamoto avr-14 C. elegans GATTGGAGAGTTAGACCACG 58981 cut S. pyogenes 24879462 Mello avr-15 C. elegans GTTTGCAATATAAGTCACCC...Katic dpy-10 C. elegans GCTACCATAGGCACCACGAG 59933 cut S. pyogenes 25161212 Fire dpy-10 C. elegans TCCGCTACCATAGGCACCA...Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...Sabatini K08F4.2 C. elegans AATCACTCCCTGTTTGTGT 66085 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans CACGAGGTGGTATGCGCAG...Seydoux K08F4.2 C. elegans CGCAGCGGTTTCCAAAATG 66092 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans GCCTTAACCCAGAATAAGA...rde-1(D718) C. elegans TGCCATTAACTATGTATGT 59927 cut S. pyogenes 25161212 Fire rde-1(D801) C. elegans GATATTGTAGTCTATCGAGA...

... to create A->G (or T->C on the opposite strand) mutations. ID Plasmid Promoter PI Publication Nick CRISPR...lower efficiency than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Browse CRISPR Plasmids By Function...-directed repair (HDR). ID Plasmid Gene/Insert Promoter PI Publication Prime Edit Cas9 H840A nickase fused...edits on an RT template. ID Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest...to your specific locus. ID Plasmid Gene/Insert Promoter PI Publication Interfere Catalytically dead dCas9...Design your gRNA to target your gene of interest’s promoter/enhancer or the beginning of the coding sequence...

...create A->G (or T->C on the opposite strand) mutations. ID Plasmid Gene/Insert Promoter Selectable Marker...-directed repair (HDR). ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Prime Edit Cas9...edits on an RT template. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Activate Catalytically...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest...to your specific locus. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Interfere Catalytically...Design your gRNA to target your gene of interest’s promoter/enhancer or the beginning of the coding sequence...to your specific locus. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Empty gRNA Expression...

...Gene/Insert Promoter Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter Selectable...Gene/Insert Promoter Selectable Marker PI Publication Drosophila ID Plasmid Gene/Insert Promoter Selectable...find a gRNA vector based on expression system, promoter, the type of gRNA (e.g., pegRNA, epegRNA, nicking...plasmid contains Cas9. ID Plasmid Expression System Promoter Guide RNA Type Cloning Enzyme Co-expressed Cas9...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...which a reverse transcriptase (RT) is fused to the C terminus of Cas9 H840A nickase. The fusion enzyme ...-Puro Mammalian, piggyBac hU6 pegRNA BsmBI No Puromycin Jacob Giehm Mikkelsen 173222 pPBT-PE2-PuroTK-pegRNA_GG...

...sgRNA with U6 promoter 48962 Worm HindIII none S. pyogenes de Bono sgRNA with rpr-1 promoter 48961 Worm ...of two sgRNAs from independent U6 promoters and Cas9 from CBh promoter. Ventura A CRISPR/Cas9 toolkit for...Cas9 + Empty sgRNA) 47549 C. elegans yes, cut S. pyogenes Goldstein DR274 42250 C. elegans BsaI none S. pyogenes...along with 1-4 sgRNAs expressed from independent promoters. sgRNAs are cloned into separate vectors and then... assembly of single gRNA vectors with various promoters, plasmids for assembling multiple gRNAs into one...pGGDestTol2LC vector. Uses five distinct zebrafish U6 promoters for sgRNA expression. Chen pCFD4-U6:1_U6:3tandemgRNAs...expression of two gRNAs from Drosophila U6:1 and U6:3 promoters. Bullock pCFD5 Drosophila Utilizes endogenous ...

...: 95 °C for 15 min, 35 cycles of (95 °C for 30 sec, 60 °C for 1 min, 72 °C for 1 min), and 72 °C for 10...following parameters: 37 °C for 30 min; 95 °C for 5 min and then ramp down to 25 °C at 5 °C/min. Dilute oligos...parameters: Cycles 1-20 (37 °C for 5 min, 20 °C for 5 min); Cycle 21 (80 °C for 20 min). These cycling ...Incubate at 30 - 37 °C for 24 - 72 hr. 30 °C may enhance genome editing efficiency, but 37 °C is acceptable....cells to incubate at 37 °C for 3 - 7 days and allow the clones to incubate at 37 °C for 7 - 14 days. Vary...thermocycler and run the following program: 65 °C for 6 min, 98 °C for 2 min to extract gDNA. Measure the DNA...clones. Run sample in thermocycler: 65 °C for 6 min and 98 °C for 2 min to extract gDNA. Screen each clone...

...pLVCT-tTR-KRAB 2nd generation; Transgene (CAG promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick...2SM2 2nd generation; Transgene (CAG promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) Off Patrick...generation; Transgene (hEF-1alpha promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick... 2nd generation; Transgene (hPGK promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick... 2nd generation; Transgene (hPGK promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) Off Patrick...generation; Transgene (hUbiquitin promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick...2nd generation; Transgene (hPrion promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick...

...lower efficiency than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Nick CRISPR/Cas nickase mutants...-directed repair (HDR). ID Plasmid Gene/Insert Promoter PI Publication Prime Edit Cas9 H840A nickase fused...edits on an RT template. ID Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest...to your specific locus. ID Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors Select...variety of Cas-containing plasmids. ID gRNA Plasmid Promoter Cloning Enzyme(s) Delivery Resistance Co-expressed...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...

...anabolic to catabolic processes. Active mTORC1 promotes protein and lipid synthesis, and increases energy... cancer. Loss of the tumor suppressor p53 also promotes aberrant mTORC1 activity, and multiple familial...mTORC1. The hyperactivation of mTORC1 in cancer promotes the conditions needed for uncontrolled cell growth... which appears to signal upstream of Akt, also promotes cell survival and proliferation. mTOR Pathway ...PKC eta PKC iota PKC theta PKC zeta Protein kinase C Protor Also known as PRR5; proline rich 5 PTEN Phosphatase...Resources The m echanistic or m ammalian t arget o f r apamycin (mTOR) is a key metabolic regulator controlling...threonine kinase 11 mTOR Mechanistic target of rapamycin NF1 Neurofibromin 1 PRAS40 Also known as AKT1S1...

...sequence (PFS). In bacteria, Cas13 targeting also promotes non-specific RNA cleavage, but this non-specific... Streptococcus , Streptomyces , and others) Drosophila Plants (monocots and dicots) C. elegans Yeast (...Zebrafish Xenopus References Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, Moineau S, Romero...23287718 Dalvai M, Loehr J, Jacquet K, Huard CC, Roques C, Herst P, Côté J, Doyon Y. 2015. A Scalable Genome-Editing-Based...Adamson B, Villalta JE, Chen Y, Whitehead EH, Guimaraes C, Panning B, Ploegh HL, Bassik MC, Qi LS, Kampmann ...