...vectors with AOX1 promoter, forward primer 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter, forward primer...metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter, forward primer Myc GCATCAATGCAGAAGCTGATCTCA... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward...ATTTAGGTGACACTATAG SP6 promoter, forward primer T3 GCAATTAACCCTCACTAAAGG T3 promoter, forward primer T7 TAATACGACTCACTATAGGG...Human U6 promoter, forward primer LNCX AGCTCGTTTAGTGAACCGTCAGATC (BD Biosciences) Human CMV promoter, forward...pombe nmt1 promoter, forward primer OpIE2 Forward CGCAACGATCTGGTAAACAC (Invitrogen) OpIE2 promoter, forward...baculovirus vector with polyhedrin promoter, reverse primer pQE promoter CCCGAAAAGTGCCACCTG (Qiagen) 5' of...

... T H A, C, or T K G or T M A or C N A, T, C, or G R A or G S C or G V A, C, or G W A or T Y C or T Amino...human cells, the promoter will be a human or mammalian promoter sequence. The promoter can also direct ...tissue-specific promoter (e.g., a liver-specific promoter). The strength of the promoter is also important...particular plasmid. Promoter Region Drives transcription of the insert. The promoter is designed to recruit...expression (i.e., a strong promoter directs high expression, whereas weaker promoters can direct low/endogenous...information about promoters, both bacterial and eukaryotic, as well as common promoters used in research...contain a promoter sequence, a transcription terminator sequence, and the inserted gene. The promoter region...

... hybrid LTR promoter (more information on this below). Additional or specialized promoters may also be...internal promoter is provided, gene expression is driven by the 5'LTR, which is a weak promoter and requires...heterologous promoter on the transfer plasmid. Expression of the transgene from this promoter is no longer...generation lentiviral plasmids utilize the viral LTR promoter for gene expression, whereas 3rd-generation transfer...within a transfer plasmid: for example, the U6 promoter is included in the pSico plasmid to drive shRNA... eliminates the requirement for Tat. LTR Viral Promoter Wild type Hybrid: 5'LTR is partially deleted and... and fused to a heterologous enhancer/promoter such as CMV or RSV Return to Top Viral Production The process...