We narrowed to 50 results for: cmv promoter
-
TypeBlog Post...induce transcription at CpG regions of various promoters. Other researchers additionally fused a TAL effector...: dCas9-p300 adds H3K27ac marks to histones in promoter and enhancer regions. These marks are associated...Figure 2: dCas9-Tet1 demethylates cytosines at promoters and enhancers. This targeted demethylation is ...Figure 3: dCas9-DNMT3A methylates cytosines at promoters and enhancers. This targeted methylation is associated...-based acetyltransferase activates genes from promoters and enhancers. Nature Biotechnology 33:510–517.... Grant Challen’s lab also created constitutive (pCMV-dCas9-D3A) and Tet-dependent (TetO-dCas9-D3A) constructs...
-
Protocol - pLKO.1 – TRC Cloning Vector
TypeProtocol...10878/ . Description Vector Element U6 Human U6 promoter drives RNA Polymerase III transcription for generation...transduced cells. hPGK Human phosphoglycerate kinase promoter drives expression of puromycin. Puro R Puromycin...be used with packaging plasmid pCMV-dR8.2 dvpr and envelope plasmid pCMV-VSVG from Robert Weinberg’s lab...Note: pLKO.1 could also be packaged using pCMV-dR8.2 dvpr and pCMV-VSVG from the Robert Weinberg lab. For... -
Sequencing Primers
TypeGuide...Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer...vectors with AOX1 promoter, forward primer 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter, forward primer...reverse primer CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer...Human U6 promoter, forward primer LNCX AGCTCGTTTAGTGAACCGTCAGATC (BD Biosciences) Human CMV promoter, forward...ATTTAGGTGACACTATAG SP6 promoter, forward primer T3 GCAATTAACCCTCACTAAAGG T3 promoter, forward primer T7 TAATACGACTCACTATAGGG...metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter, forward primer...Nopaline synthase promoter, forward primer Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter, forward primer... -
New CRISPR Web Resources and #12DaysofCRISPR Recap
TypeBlog Post...pC016 - LwCas13a guide expression backbone with U6 promoter has already earned a blue flame. RNA Editing: ...cytosine base editor pCMV-BE3 has been requested nearly 400 times, and newcomer pCMV-ABE7.10 has already... -
Lentiviral Vector Guide
TypeGuide...with a heterologous promoter (CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter; the transcript begins... chimeric 5’ LTR fused to a heterologous promoter (often CMV or RSV), eliminating the need for transactivation...LTR for self-inactivation LTR Viral Promoter Wildtype Hybrid promoter; 5' LTR is partially deleted and fused... fused to a heterologous enhancer/promoter such as CMV or RSV Table 1. Summary of key differences between... use a hybrid 5' LTR with a constitutive promoter such as CMV or RSV. 3' LTR in cis Terminates transcription...plasmids include tat , as the 5’ LTR is used as a promoter on the transfer plasmid, and this requires Tat...cell lines, VSV-G is often put under an inducible promoter. Depending on the cell type, there are other envelope... -
15 Hot Plasmids from 2017
TypeBlog Post...Chien lab (Kwan et al., 2007) and includes four promoters, six fluorophores with nonoverlapping emission...neurodegenerative diseases, the Cole Lab selected promoters for cell types directly linked to disease, including... components can be controlled by a variety of promoters for versatile and robust engineering. These components... activity; protein purification vector 87439 pCMV-HF-BE3 HF-Cas9 (NGG) Very low off-target activity... -
Gamma-Retroviral Vector Guide
TypeGuide...heterologous promoter (usually CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter; the transcript... use a hybrid 5' LTR with a constitutive promoter such as CMV or RSV. 3' LTR in cis Terminates transcription... to prefer transcription start sites, such as promoters and enhancers. Many times, integration sites are...cell lines, VSV-G is often put under an inducible promoter. Depending on the cell type, there are other envelope...selection is driven by strong enhancers and active promoters. Nucleic Acids Research , 42 (7), 4257–4269. https... -
Promoters
TypeGuide...Reference Molecular Biology Reference Promoters Promoters Definition A promoter is a region of DNA where transcription...silencers. Promoter Regions There are three main portions that make up a promoter: core promoter, proximal...Proximal Promoter Further upstream from the core promoter you will find the proximal promoter which contains...bind. Distal Promoter The final portion of the promoter region is called the distal promoter which is upstream.... Common Eukaryotic Promoters Used in Research Promoter Expression Description CMV Constitutive Strong...Specific Drosophila promoter containing Gal4 binding sites Bacterial Promoters Promoters in bacteria contain...tryptophan Promoter from E. coli tryptophan operon Ptac Regulated like the lac promoter Hybrid promoter of lac... -
Plan Your Experiment
TypeGuide...Cas enzyme promoter can be constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically...Cas enzyme and gRNA Species of promoter and expression pattern of promoter for Cas enzyme and gRNA Presence...such as dCas9-KRAB) or dCas9 gRNA(s) targeting promoter elements of target gene dCas9-KRAB is more effective...activator (such as dCas9-VP64) gRNA(s) targeting promoter elements of target gene Many different activators...dCas9-repressors, gRNAs should be targeted to the promoter driving expression of your gene of interest. For... -
Trimmer Lab NeuroMab Collection
TypeCollection...green) and heavy (blue) chains as driven by two CMV promoters (orange). Hybridoma-derived V L and V H domain...κ light chain polyA tail sequences (κ pA), a CMV promoter for heavy chain expression, and an ER signal... the p1316 plasmid that contains an upstream CMV promoter for light chain expression, and an ER signal...