Skip to main content
Addgene

We narrowed to 906 results for: nes

Showing: 41 - 60 of 906 results
  1. CRISPR History and Development for Genome Engineering

    Type
    Collection
    .... 25(10):1581-9. PMID: 26355004 Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelson T, Heckl... anti-CRISPR genes in bacteriophages infecting Pseudomonas aeruginosa . Anti-CRISPR genes employ varied...system - utilizing various CRISPR-associated (Cas) genes to not only store a record of invading phages but...Cas proteins. Makarova et al. ’s classification defines 5 types and 16 subtypes based on shared characteristics...genomic DNA. Type II CRISPR was the first system harnessed for genome engineering, with Type V following ...Csf1) Type VI (Cas13) Fighting Back: Anti-CRISPR Genes in Phage The CRISPR adaptive immune system seems.... Pooled gRNA libraries can be used to identify genes that are important to a given phenotype. Current...
  2. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...pmTurquoise2-NES Non-nucleus Nuclear Export Sequence mTurquoise2 Dorus Gadella 85062 pmScarlet-i_NES_C1 Non-nucleus...pmScarlet-H_NES_C1 Non-nucleus Nuclear Export Sequence mScarlet-H Dorus Gadella 85060 pmScarlet_NES_C1 Non-...Plasmids encoding fluorescent proteins tagged with genes or peptides with known subcellular localization ...Localization More Fluorescent Protein Resources: Empty Backbones Allen Institute for Cell Science Plasmid Collection...proteins that enter the secretory pathway require chaperones to help with folding or post-translational modification...
  3. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Li Norepinephrine nLight red and green GPCR-based NE indicators Sensitive multicolor indicators for monitoring...Norepinephrine GRAB_NE family of GPCR activation-based NE sensors A Genetically Encoded Fluorescent Sensor ...fluorescent biosensors to measure biomolecules or genes via FRET or other assays. Plasmid...specific biomolecules, the activity of specific genes and cellular processes, or other factors like environmental...Campbell Calcium Ratiometric calcium biosensors from nested reporters of green- and orange-emitting proteins...proteins Ratiometric Matryoshka biosensors from a nested cassette of green- and orange-emitting fluorescent...mScarlet-based calcium sensor with exceptional brightness, photostability, and multiplexing capabilities...
  4. Lentiviral CRISPR Libraries Enable Genome-Scale, Knockout Screening

    Type
    Blog Post
    ...Knockout Screening in Human Cells. Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelson T, Heckl...and easily manipulate specific genes. But what if you want to study genes all across the genome? Two new...screen for genes involved in bacterial toxin resistance, identifying 4 previously unknown genes.  “With ...library, which they call GeCKO, targets 18,080 human genes with 64,751 unique guide sequences to enable both...including Feng Zhang used the GeCKO library to identify genes essential for cell viability in cancer and pluripotent...In a melanoma model, they also went in search of genes involved in resistance to the cancer drug vemurafenib...guide RNAs (gRNAs) covering a total of 7,114 human genes. Unlike the GeCKO library, each library has been...
  5. New Norepinephrine Indicators: nLightG and nLightR

    Type
    Blog Post
    ...expressing nLightG or nLightR before/after application of NE (10 μM) and corresponding pixel-wise ΔF/F0 heatmaps... expression of the indicators over white dashed lines. Scale bars, 10 μm (HEK293T), 20 μm (neurons). Figure...options for multiplexing in experiments, including ones that study alpha2-AR. Selectivity Norepinephrine...
  6. Top Requested Lentivirus and AAV of 2016

    Type
    Blog Post
    ...Feb;10(4):337-47. PubMed PMID: 12595892. 4. Sanjana NE, Shalem O, Zhang F. Improved vectors and genome-wide...virus can be used to generate Cas9-expressing cell lines, which can then be used both for screens (using ...
  7. Isolating a Monoclonal Cell Population by Limiting Dilution

    Type
    Protocol
    ...genome-wide libraries for CRISPR screening. Sanjana NE, Shalem O, Zhang F. Nature Methods. 2014 Aug;11(8.... After the monoclonal lines have been sufficiently expanded, screen the lines for transgene expression...transgene expression over time, as the lower expressing clones take over the polyclonal cell pool. Generating ...details, see our protocol for generating stable cell lines with lentivirus . Day 0: (optional) Seed cells for... cells Day 14–30: Analyze and expand monoclonal lines of interest Equipment Class II, Type A2 Biological...Heat-inactivated FBS 1X PBS pH 7.4 without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment...pool: see our protocol for generating stable cell lines with lentivirus . Pro-Tip Because the polyclonal...
  8. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...specific genes using dCas9-VP64 activator fragments (dCas9(C)-FKBP-2xNLS-VP64 and dCas9(N)-FRB-NES). This...FKBP rapamycin binding domain of mTor (Cas9(N)-FRB-NES) resulting in a rapamycin-inducible Cas9 for genome...editing. Without rapamycin treatment, the Cas9(N)-FRB-NES fragment is actively shuttled out of the nucleus ...sequence. Treatment with rapamycin induces Cas9(N)-FRB-NES and Cas9(C)-FKBP-2xNLS dimerization and net influx...of downstream genes. Nihongaki et al describe the targeted activation of endogenous genes and detail the... promoter-less Gateway® entry clones to be used with other entry clones encoding the ORFs of interest:...neuron-like” phenotype when targeting genes involved in neurogenesis, which had proven challenging using...
  9. Negative Can Be Positive: Open AAV Data with Addgene

    Type
    Blog Post
    ...beta-hydroxylase (DBH, magenta) to label norepinephrine (NE) expressing neurons and GFP (green) to label neurons...’m willing to bet the answer would be along the lines of “we have a lot”. In fact, scientists often cite..., C. M., Leib, R. D., Cirolia, G., Thomas, D., Stamnes, S., Holt, K., Sinn, P., May, A. P., & Paulk, N...availability upon request differ across scientific disciplines. Scientific Data, 8(1), 1–11. https://doi.org...
  10. Lentiviral Vector Uses and Overview

    Type
    Blog Post
    ...genome-wide libraries for CRISPR screening. Sanjana NE, Shalem O, Zhang F. Nat Methods. 2014 Aug;11(8):783...2nd-generation lentiviral system (Figure 2). The HIV genes that do remain are very important for viral production...make stable transgene-expressing or knockout cell lines. Many CRISPR plasmids are designed for lentiviral...integrate into the genome, they could promote oncogenesis by altering local gene expression. Self-inactivating...LTR that prevents aberrant activation of nearby genes. These safer vectors have become standard in gene...
  11. Tips for a 1st Time CRISPR User (by a 1st Time CRISPR User)

    Type
    Blog Post
    ...genome-wide libraries for CRISPR screening. Sanjana NE, Shalem O, Zhang F. Nat Methods. 2014 Aug;11(8):783...cells were then used to generate a monoclonal cell lines by limiting dilution. The rest of the cells were... you’re doing a screen. I made a few monoclonal lines (Figure 2) and I was surprised at how variable Cas9... Figure 2: Cas9 expression in monoclonal cell lines generated from A549 cells transduced with lentiCas9...results. (Figure 5). The digestion product (Figure 4, lanes 0.3 % 3.0, Figure 5, lane 2) is faint, so comparing...formed from control (GFP gRNA-targeted) BRAF sites (lanes 3, 4) were used as controls. Duplexes were generated...Resources at Addgene.org Generating Stable Cell Lines with Lentivirus Isolating a Monoclonal Cell Population...
  12. Validated gRNA Sequences

    Type
    Collection
    ...cut S. pyogenes 26028531 Huangfu OCT4 H. sapiens multiple, see article 69537 activate S. pyogenes 26352799...cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 41818 cut S. pyogenes 23287722... cut S. pyogenes 24336569 Sabatini AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 70661 cut S. pyogenes 26472758...cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes 25739462...cut S. pyogenes 25352017 Zaratiegui ade6-M210 S. pombe TCTATTGTTCAGATGCTTCG 52226 cut S. pyogenes 25352017... 52225 cut S. pyogenes 25352017 Zaratiegui Alk and Eml M. musculus 64071 cut S. pyogenes 25337876 Ventura...cut S. pyogenes 26472758 Sabatini ANT1 S. lycopersicum TGTCGTTTATAATTTGTAGA 70019 cut S. pyogenes 26541286...
  13. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...BsaI none S. pyogenes Chloramphenicol Marraffini pCas9 42876 Bacteria BsaI yes, cut S. pyogenes Chloramphenicol...none S. pyogenes Qi pDD162 (Peft-3::Cas9 + Empty sgRNA) 47549 C. elegans yes, cut S. pyogenes Goldstein...elegans BsaI none S. pyogenes Joung pCFD3-dU6:3gRNA 49410 Drosophila BbsI none S. pyogenes Virmilion Bullock..., cut S. pyogenes Puro Liu pCFD4-U6:1_U6:3tandemgRNAs 49411 Drosophila BbsI none S. pyogenes Virmilion...Mammalian AfIII none S. pyogenes Bleocin Church MLM3636 43860 Mammalian BsmBI none S. pyogenes Joung pSPgRNA 47108...none S. pyogenes Gersbach pUC57-sgRNA expression vector 51132 Mammalian BsaI none S. pyogenes Huang pAC154... yes, activate S. pyogenes Jaenisch pSQT1313 53370 Mammalian BsmBI none S. pyogenes Joung PX461 (3rd Gen...
  14. CRISPR Plasmids - Plants

    Type
    Collection
    ... aU6 BsaI none S. pyogenes Kamoun 52255 pUC119-gRNA U6 PCR template none S. pyogenes Sheen 51295 pRGEB31...snoRNA U3 BsaI none S. pyogenes Yang 50579 pBUN6A11 OsU3 BsaI yes, activate S. pyogenes Bar Chen 50580 pBUN6I11...yes, interfere S. pyogenes Bar Chen 50582 pBUN501 AtU6-26 BsaI yes, nick S. pyogenes Bar Chen 50594 pCBC-MT2T3... paper BsaI none S. pyogenes Chen 50595 pCBC-MT3T4 see paper BsaI none S. pyogenes Chen 62204 pBUN421 ...TaU3 BsaI yes, cut S. pyogenes Bar Chen 53063 pU3-gRNA OsU3 AarI none S. pyogenes Gao 53061 pZmU3-gRNA ...gRNA maize U3 none S. pyogenes Gao 53062 pU6-gRNA wheat U6 BbsI none S. pyogenes Gao 59188 pBlu/gRNA Arabidopsis...Arabidopsis U6 BbsI none S. pyogenes Stupar 62200 pBUE411 OsU3 yes, cut S. pyogenes Basta Chen 62203 pHUE411...
  15. CRISPR Guide

    Type
    Collection
    ...repress, visualize, and isolate genes. Activation or Repression of Target Genes Figure 9: Overview of CRISPRi... and a user-defined ∼20-nucleotide spacer that defines the genomic target to be modified. You can therefore...CRISPR was originally employed to knock out target genes in various cell types and organisms, but modifications... ability to selectively activate/repress target genes, purify specific regions of DNA, image DNA in live...Multiplexing applications include editing multiple genes at once; using dual nickases to generate a knockout... used to knock out, activate, or repress target genes when paired with the appropriate Cas enzyme. Specific...CRISPR specificity. SpCas9 (from Streptococcus pyogenes ) is the most popular Cas endonuclease, with many...
  16. Lentiviral Prep Service

    Type
    Collection
    ...Screening Use pooled CRISPR libraries to screen for genes involved in specific biological processes. For more... Plasmid Pooled Libraries . ID Name Description Genes/Insert Selection PI Human knockout pooled libraries...library in backbone lentiGuide-Puro targeting 19,114 genes and containing 76,441 unique sgRNAs along with 1000...SpCas9. 76,441 unique sgRNAs targeting 19,114 human genes along with 1000 non-targeting controls Puromycin...library in backbone lentiCRISPRv2 targeting 19,114 genes and containing 76,441 unique sgRNAs along with 1000...and 76,441 unique sgRNAs targeting 19,114 human genes along with 1000 non-targeting controls Puromycin... in backbone XPR_502 (P65 HSF) targeting 18,885 genes and containing 56,762 unique sgRNAs. This backbone...
  17. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...AAV-EF1a-BbTagBY Control Joshua Sanes AV-9-PV2454 45186-AAV9 AAV-EF1a-BbChT Control Joshua Sanes AV-9-PV2629 100043...Looger, Eric Schreiter AV-1-PV3844 100855-AAV1 pAAV.CAG.Flex.NES-jRGECO1b.WPRE.SV40 Biosensor GENIE, Douglas...Douglas Kim AV-1-PV3845 100856-AAV1 pAAV.Syn.Flex.NES-jRGECO1b.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1...-1-PV3846 100857-AAV1 pAAV.Syn.NES-jRGECO1b.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV3847 100852-...100852-AAV1 pAAV.CAG.Flex.NES-jRGECO1a.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV3848 100853-AAV1 pAAV....Biosensor GENIE, Douglas Kim AV-1-PV3849 100854-AAV1 pAAV.Syn.NES-jRGECO1a.WPRE.SV40 Biosensor GENIE, Douglas ...Douglas Kim AV-1-PV3850 100849-AAV1 pAAV.CAG.Flex.NES-jRCaMP1b.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV3851...
Showing: 41 - 60 of 906 results