Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 20 of 115 results

  1. TALENs for Endogenous Human Genes

    Type
    Collection
    ...Pre-constructed pairs of TALEN plasmids targeting human genes involved in cancer and epigenetic regulation from...TALengineering Reagents TALEN Reagents for Human Genes Engineered TALENs for Endogenous Human Gene Targets...large series of engineered TALENs targeted to human genes involved in cancer and/or epigenetic regulation ...

  2. TALENs for Endogenous Zebrafish Genes

    Type
    Collection
    ...Pre-constructed pairs of TALEN plasmids targeting zebrafish genes....target sites within various endogenous zebrafish genes; many of these were generated as part of an NIH-...TGCCTGGCACAGGGGCTctccaccatgctggccAACCTGTTCTCAATGA kinesin-family-member-13a TAL3106 & TAL3107 TGTTCTCTGTTTGAGCGAgtctccacacagcagaGCGACAGTAACAGCTTCA...

  3. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...in Mammalian Cell Lines CRISPR: Protocol for Genomic Deletions in Mammalian Cell Lines Other Addgene Resources...loss-of-function studies of genes and genetic elements in mammalian cell lines. Protocol For referenced ...CRISPR/Cas9 Clones for Deletions and Clone Selection For suspension cells, transfer all clones to a single...Validation of Biallelic Deletion Clones In order to characterize obtained clones and validate a successful knockout...JoVE) about genomic deletions in mammalian cell lines using CRISPR/Cas9 CRISPR...Cas9 to create genomic deletions in mammalian cell lines. Along with the video, you can find the protocol...Generation of Genomic Deletions in Mammalian Cell Lines via CRISPR/Cas9. Bauer DE, Canver MC, Orkin SH. ...

  4. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Fluorescent Protein Guide Empty Backbones Fluorescent Protein Guide: Empty Backbones More Fluorescent Protein...Addgene has assembled a collection of empty plasmid backbones with different fluorescent tags for you to create...generated with the help of Erik Snapp . Empty Backbones for Fluorescent Protein Fusions (Organized by ...Excitation and Emission maximum are listed in nm. Brightness is the product of exctinction coefficient and...Blue/UV Protein Excitation (nm) Emission (nm) Brightness pKa Maturation Structure Plasmids Sirius 355 ...Top Cyan Protein Excitation (nm) Emission (nm) Brightness pKa Maturation Structure Plasmids Aquamarine ...

  5. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...A guide to Addgene's empty vector backbones curated by species, epitope tags/fusion protein, selectable... Plasmid Collections Empty Backbones Choosing Your Perfect Plasmid Backbone Background...consider. Here is a guide to Addgene's empty vector backbones. For the most part, we will assume that you... Host Relevant Promoters Representative Empty Backbones Mammalian CMV, SV40, EF1a, CAG pSG5L Flag HA -... high expression of UAS-driven transgenes Worm unc-54, variety of worm gene promoters C... and Lehner Lab vectors - Tools for nematode transgenesis Insect / Baculovirus Polyhedrin pFastBac LIC...Protein Common uses Representative Empty Backbones Flag Epitope tag pcDNA3 Flag HA - ...

  6. Guide RNA Expression Plasmids for Endogenous Human Genes

    Type
    Collection
    ...Guide RNA Expression Plasmids for Endogenous Human Genes...CRISPR-Cas/RGN expression plasmids for Human genes You may also like... CRISPR Guide CRISPR Protocols gRNA...technology to modify four different endogenous human genes (Fu et al., Nat Biotechnol. 2013). The expression...

  8. Brain Initiative Collection

    Type
    Collection
    ...the genetically-encoded fluorescent norepinephrine(NE) sensor GRAB_NE1m in neurons Yulong Li 123308-AAVrg...the genetically-encoded fluorescent norepinephrine(NE) sensor GRAB_NE1m in neurons Yulong Li 123309-AAV9...the genetically-encoded fluorescent norepinephrine(NE) sensor GRAB_NE1h in neurons Yulong Li 123309-AAVrg...the genetically-encoded fluorescent norepinephrine(NE) sensor GRAB_NE1h in neurons Yulong Li 123310-AAV9...the genetically-encoded fluorescent norepinephrine(NE) control sensor GRAB_NEmut in neurons Yulong Li 123310...the genetically-encoded fluorescent norepinephrine(NE) control sensor GRAB_NEmut in neurons Yulong Li 125560...combination with Cre-dependent transgenic mouse lines or co-infection with Cre dependent viral vectors...

  9. Retrograde AAV viral preps

    Type
    Collection
    ...Syn genetically-encoded fluorescent norepinephrine(NE) sensor GRAB_NE1m Norepinephrine sensor Li 123309...Syn genetically-encoded fluorescent norepinephrine(NE) sensor GRAB_NE1h Norepinephrine sensor Li 123310...control norepinephrine sensor (does not respond to NE) Norepinephrine sensor Li Optogenetics 20297 pAAV-EF1a-double...serotype to deliver Cre-dependent transgenes in Cre transgenic lines. As part of our standard viral production...nuclear dTomato Calcium sensor Ting 100853 pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 Syn Cre-dependent jRGECO1a...jRGECO1a Calcium Sensor Kim , GENIE 100854 pAAV.Syn.NES-jRGECO1a.WPRE.SV40 Syn jRGECO1a Calcium Sensor Kim...

  10. Zhang Lab CRISPR Page

    Type
    Collection
    ...knockout screening in human cells. Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelsen TS, Heckl...genome-wide libraries for CRISPR screening. Sanjana NE, Shalem O, Zhang F. Nat Methods . 2014 Aug;11(8):...contain a combination of CRISPR-associated (Cas) genes as well as non-coding RNA elements capable of programming...CRISPR-mediated nucleic acid cleavage. We have harnessed the type II CRISPR nuclease system to facilitate...implemented in mammalian cells by co-expressing the S. pyogenes Cas9 (SpCas9) nuclease along with the guide RNA...for the transcriptional activation of endogenous genes. It consists of three components: A nucleolytically..., Nature 2015). The dual vector system uses S. pyogenes Cas9 (SpCas9), using one vector to express SpCas9...

  11. Biosensor AAV Preps

    Type
    Collection
    ...SF-iGluSnFr Glucose Sensors iGlucoSnFr Norepinephrine (NE) Sensors GRAB_NE Voltage Reporters Archon Voltron...iGlucoSnFr mRuby2 Constitutive 9 Looger Norepinephrine (NE) Sensors 123308 pAAV-hSyn-GRAB_NE1m Syn GRAB_NE1m... Griesbeck Calcium Sensor: jRCaMP1 100846 pAAV.CAG.Flex.NES-jRCaMP1a.WPRE.SV40 CAG jRCaMP1a none Cre dependent... dependent 1 Kim , GENIE 100848 pAAV.Syn.NES.jRCaMP1a.WPRE.SV40 Syn jRCaMP1a none Constitutive 1, 9 Kim...Kim , GENIE 100849 pAAV.CAG.Flex.NES-jRCaMP1b.WPRE.SV40 CAG jRCaMP1b none Cre dependent 1 Kim , GENIE ...GENIE 100850 pAAV.Syn.Flex.NES-jRCaMP1b.WPRE.SV40 Syn jRCaMP1b none Cre dependent 1 Kim , GENIE 100851 pAAV.Syn.NES-jRCaMP1b.WPRE.SV40...CaMPARI none Constitutive 1, 5, 9 Looger 101060 pAAV_hsyn_NES-his-CaMPARI2-WPRE-SV40 Syn CaMPARI2 his Constitutive...

  12. Genetic Code Expansion

    Type
    Collection
    ...Bacterial TAG Ryan Mehl 174081 pAcBac1-NES-Flag-R2-84-MbRS Tetrazine3.0 NES-Flag-R2-84 tRNA synthetase M. barkeri...growth medium, ncAA concentration, and the cell lines used previously. Remember that the orthogonal pairs...aminoacylate only the orthogonal tRNA, and not endogenous ones. Endogenous synthetases cannot aminoacylate the ...Andrea Musacchio 182287 pcDNA3.1(+)_U6 tRNAPyl_CMV NESPylRS(AF) Y306A/Y384F (AF) pyrrolysine (Pyl) tRNA synthetase...Nikić-Spiegel 182652 pcDNA3.1(+)_4x(U6 tRNA M15)_CMV NESPylRS(AF) Y306A/Y384F (AF) pyrrolysine (Pyl) tRNA synthetase...Nikić-Spiegel 182653 pcDNA3.1(+)_U6 tRNAPyl_CMV NESPylRS(AF)_IRES_eRF1(E55D)-HA Y306A/Y384F (AF) pyrrolysine... 197099 pIYN3 TyrRS M. jannaschii halogenated tyrosines Bacterial TAG Kensaku Sakamoto 197100 pCDF-Mm2...

  13. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...pcDNA3.1-hSNCA-NE SNCA NE CMV Parkinson's Shu Leong Ho 102363 pcDNA3.1-hNurr1-NE NR4A2 NE CMV Parkinson's...pSIN-PAmCherry-mSNCA-NE SNCA NE EF-1 alpha Parkinson's Shu Leong Ho 102366 pSIN-hSNCA-NE SNCA NE EF-1 alpha Parkinson's...Alzheimer's Hélène Marie 107544 pAAV-AICD-NES-IRES-hrGFP APP V5 CMV Alzheimer's Hélène Marie 107548 pAAV-syn-AICD-IRES-hrGFP...pAAV-syn-AICD-IRES-hrGFP APP hSyn1 Alzheimer's Hélène Marie 107594 pCS2-sod1 SOD1 SP6 ALS Qing Deng 107798...SFFV Parkinson's Denes Hnisz 145270 pHR-TBP(53Q)-IDR-mCherry-Cry2-NLS TBP Parkinson's Denes Hnisz 145283 ...as fluorescent protein (FP) tags. Information on genes and associated neurodegenerative diseases was curated...145283 pET-45b-TBP(38Q)-IDR-mCherry TBP Parkinson's Denes Hnisz 146392 pAc5.1B-lambdaN-HA-DmeIF4G-trunc-V5His6...

  14. CRISPR History and Development for Genome Engineering

    Type
    Collection
    .... 25(10):1581-9. PMID: 26355004 Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelson T, Heckl... anti-CRISPR genes in bacteriophages infecting Pseudomonas aeruginosa . Anti-CRISPR genes employ varied...system - utilizing various CRISPR-associated (Cas) genes to not only store a record of invading phages but...Cas proteins. Makarova et al. ’s classification defines 5 types and 16 subtypes based on shared characteristics...genomic DNA. Type II CRISPR was the first system harnessed for genome engineering, with Type V following ...Csf1) Type VI (Cas13) Fighting Back: Anti-CRISPR Genes in Phage The CRISPR adaptive immune system seems.... Pooled gRNA libraries can be used to identify genes that are important to a given phenotype. Current...

  15. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...pmTurquoise2-NES Non-nucleus Nuclear Export Sequence mTurquoise2 Dorus Gadella 85062 pmScarlet-i_NES_C1 Non-nucleus...pmScarlet-H_NES_C1 Non-nucleus Nuclear Export Sequence mScarlet-H Dorus Gadella 85060 pmScarlet_NES_C1 Non-...Plasmids encoding fluorescent proteins tagged with genes or peptides with known subcellular localization ...Localization More Fluorescent Protein Resources: Empty Backbones Allen Institute for Cell Science Plasmid Collection...proteins that enter the secretory pathway require chaperones to help with folding or post-translational modification...

  16. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Li Norepinephrine nLight red and green GPCR-based NE indicators Sensitive multicolor indicators for monitoring...Norepinephrine GRAB_NE family of GPCR activation-based NE sensors A Genetically Encoded Fluorescent Sensor ...fluorescent biosensors to measure biomolecules or genes via FRET or other assays. Plasmid...specific biomolecules, the activity of specific genes and cellular processes, or other factors like environmental...Campbell Calcium Ratiometric calcium biosensors from nested reporters of green- and orange-emitting proteins...proteins Ratiometric Matryoshka biosensors from a nested cassette of green- and orange-emitting fluorescent...reticulum. Biophys Rep (2019) 5, 31–42 Pingyong Xu Magnesium Fluorescent Mg2+ sensor (MARIO) A Transient Rise...

  17. CRISPR Guide

    Type
    Collection
    ...genomics using CRISPR-Cas9. 2015. Shalem O, Sanjana NE, Zhang F. Nat Rev Genetics . 16(5):299-311. PMID:...Screening in Human Cells. 2014. Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelson T, Heckl... and a user-defined ∼20 nucleotide spacer that defines the genomic target to be modified. Thus, one can...CRISPR was originally employed to knock out target genes in various cell types and organisms, but modifications...extended CRISPR to selectively activate/repress target genes, purify specific regions of DNA, image DNA in live... Cas protein you use. We'll use the popular S. pyogenes Cas9 (SpCas9) as an example, but check out our...insertions or deletions (indels) at the DSB site. The randomness of NHEJ-mediated DSB repair has important practical...

  18. Validated gRNA Sequences

    Type
    Collection
    ...cut S. pyogenes 26028531 Huangfu OCT4 H. sapiens multiple, see article 69537 activate S. pyogenes 26352799...cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 41818 cut S. pyogenes 23287722... cut S. pyogenes 24336569 Sabatini AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 70661 cut S. pyogenes 26472758...cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes 25739462...cut S. pyogenes 25352017 Zaratiegui ade6-M210 S. pombe TCTATTGTTCAGATGCTTCG 52226 cut S. pyogenes 25352017... 52225 cut S. pyogenes 25352017 Zaratiegui Alk and Eml M. musculus 64071 cut S. pyogenes 25337876 Ventura...cut S. pyogenes 26472758 Sabatini ANT1 S. lycopersicum TGTCGTTTATAATTTGTAGA 70019 cut S. pyogenes 26541286...

  19. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...BsaI none S. pyogenes Chloramphenicol Marraffini pCas9 42876 Bacteria BsaI yes, cut S. pyogenes Chloramphenicol...none S. pyogenes Qi pDD162 (Peft-3::Cas9 + Empty sgRNA) 47549 C. elegans yes, cut S. pyogenes Goldstein...elegans BsaI none S. pyogenes Joung pCFD3-dU6:3gRNA 49410 Drosophila BbsI none S. pyogenes Virmilion Bullock..., cut S. pyogenes Puro Liu pCFD4-U6:1_U6:3tandemgRNAs 49411 Drosophila BbsI none S. pyogenes Virmilion...Mammalian AfIII none S. pyogenes Bleocin Church MLM3636 43860 Mammalian BsmBI none S. pyogenes Joung pSPgRNA 47108...none S. pyogenes Gersbach pUC57-sgRNA expression vector 51132 Mammalian BsaI none S. pyogenes Huang pAC154... yes, activate S. pyogenes Jaenisch pSQT1313 53370 Mammalian BsmBI none S. pyogenes Joung PX461 (3rd Gen...

  20. CRISPR Plasmids - Plants

    Type
    Collection
    ... S. pyogenes Bar Chen pU3-gRNA OsU3 AarI none S. pyogenes Gao pZmU3-gRNA maize U3 none S. pyogenes Gao...AtU6p aU6 BsaI none S. pyogenes Kamoun pUC119-gRNA U6 PCR template none S. pyogenes Sheen pRGEB31 rice snoRNA...snoRNA U3 BsaI none S. pyogenes Yang pBUN6A11 OsU3 BsaI yes, activate S. pyogenes Bar Chen pBUN6I11 OsU3...BsaI yes, interfere S. pyogenes Bar Chen pBUN501 AtU6-26 BsaI yes, nick S. pyogenes Bar Chen pCBC-MT2T3 ...see paper BsaI none S. pyogenes Chen pCBC-MT3T4 see paper BsaI none S. pyogenes Chen pBUN421 TaU3 BsaI...wheat U6 BbsI none S. pyogenes Gao pBlu/gRNA Arabidopsis U6 BbsI none S. pyogenes Stupar pBUE411 OsU3 yes... yes, cut S. pyogenes Basta Chen pHUE411 OsU3 yes, cut S. pyogenes Hyg Chen pHAtC U6 AarI yes, cut S. ...
Showing: 1 - 20 of 115 results