Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 562 results for: pac

Showing: 41 - 60 of 562 results

  2. University of Florida Serotype Testing Panel for the Eye and Brain

    Type
    Collection
    ... Viral Vector Packaging Service AAV University of Florida Serotype Testing...Testing Panel for the Eye and Brain Viral Vector Packaging Service: University of Florida Serotype Testing... directly to the brain parenchyma or subretinal space Serotypes The following serotypes were developed...acknowledge Shannon Boye and cite Boye, et al. 2016. Impact of Heparan Sulfate Binding on Transduction of Retina...32304666 Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...

  4. Water Bath Protocol

    Type
    Protocol
    ...bath, and be sure to know what the maximum fill capacity is. Look for a “fill” line inside the water bath...

  5. AAV Viral Preps

    Type
    Collection
    ... (AAV) available from Addgene's viral vectory packaging service. Browse constructs currently available... Viral Vector Packaging Service AAV Browse In-Stock AAV Adeno-associated virus (AAV...can't find the prep you need, try Addgene's AAV Packaged on Request service. You can choose a transfer ...transfer plasmid from our repository and request packaging in one of seven serotypes (AAV1, AAV2, AAV5, AAV6,... For more information, visit our Viral Vector Packaging Service overview. Function Chemogenetics DREADDs...

  6. Viral Prep Service for Plasmids and Pooled Libraries

    Type
    Collection
    ...Browse Lenti Packaged on Request Can't find what you need in our in-stock preps? Our Packaged on Request...the viral vector prep you need. Packaged on Request Viral Vector Packaging Service Information Production... Viral Vector Packaging Service Addgene produces high-quality viral vector...

  7. SARS-CoV-2 Pseudotyped Virus

    Type
    Collection
    ...Plasmids Envelope and Packaging Plasmids Popular Lentiviral Envelope and Packaging Plasmids Popular γ-Retrovirus...leukemia virus, and vesicular stomatitis virus G) are packaged as replication-defective virus particles with ...SARS-CoV-2 and other coronaviruses using appropriate packaging plasmids. Use the search bar to find a particular...-Retrovirus Envelope and Packaging Plasmids Reporter Plasmids A few examples of reporter plasmids that...

  8. Video Library

    Type
    Protocol
    ...personal protective equipment, setting up a clean workspace, and maintaining sterility while working. AAV ...

  9. Experimenting in an Open Source lab: from CRISPR to Cats

    Type
    Blog Post
    ...1,000 active makerspaces around the world. Hackerspaces.org maintains a list of active spaces near you. ...@derekja  Resources Hackerspace Website https://wiki.hackerspaces.org/Hackerspaces OpenWorm Project Website...manifested itself in the creation of Hackerspaces and Makerspaces back in 2007, which function as centres...with the OpenWorm Project One such space is the Victoria Makerspace in Canada, which I belong to. The ...  Funding Makerspaces One of the main challenges when starting a new project at a makerspace is finding... can find a makerspace somewhere near you. The place to start looking for your local space is the Hackerspace...competition. In 2010, he founded makerspace.ca, Victoria’s first hackerspace which now offers members and ...

  10. Plan Your Experiment

    Type
    Collection
    ...vectors is that the packaging limit (how large of a DNA sequence you can actually package into your viral ...Edit References CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeats) is a powerful system...efficiencies. The template sequences can also have a large impact on editing efficiency. So while testing multiple...promoters, and selection markers. There are also no packaging limits as there are for viral vectors — the only... Addgene's in-stock AAV preps or try Addgene's Packaged on Request service. Delivery Using mRNA and Proteins...

  11. Supporting Reproducibility with a Connected ELN

    Type
    Blog Post
    ... take a look at the RSpace ELN.  The connected approach in action: how the RSpace ELN supports reproducibility...repositories. RSpace has been integrated with two of the five: Figshare and Dataverse, as well as the DSpace repository... reproduce an experiment documented in RSpace using the RSpace datasets deposited in Figshare or Dataverse...Rory is founder and CEO of Research Space, which provides the RSpace electronic lab notebook. Rory is based...contributed by Rory Macneil, founder of Research Space. There are many types of electronic lab notebooks...reproducibility RSpace was designed in response to requirements that emerged from intensive engagement with...byproduct of connectivity. Between 2012 and 2017 RSpace was developed with these principles in mind, and...

  12. Overcoming the Challenges of Lentiviral Production

    Type
    Blog Post
    ...generation packaging systems use 3 plasmids; an envelope plasmid that usually encodes VSV-G, a packaging plasmid...lentiviral packaging systems please see Addgene’s Lentiviral Guide. While the third generation packaging systems...requirement for additional DNA can impact the transfection efficiency of the packaging cell line and thereby affect...are transfected into a packaging cell line, usually a derivative of 293T. Packaging cells are incubated ...delivering genes via lentivirus is deciding what packaging system is best for a particular experiment. The...The newer generation lentiviral packaging systems were designed to prevent the formation of replication...reduce the risk of such events, newer lentiviral packaging systems divide the viral elements among multiple...

  13. Your Lentiviral Plasmid FAQs Answered

    Type
    Blog Post
    ...lentiviruses the same thing? Can I package lentivirus with retroviral packaging plasmids (and vice versa)? A1...plasmids can be packaged with either system. Please note that the generation used to package the virus does...co-transfecting three essential ingredients: the lentiviral packaging vector, a transfer vector including the gene of... an envelope. Three generations of lentiviral packaging systems have been developed over the years based...most experiments; however, the 3rd-generation packaging systems offer the maximal biosafety available ...different plasmids into the producer cells (two packaging plasmids, an envelope plasmid, and the lentiviral...and gamma-retroviruses use the same genes for packaging (that's gag, pol, and env), the isoforms of these...

  14. Optogenetics AAV Preps

    Type
    Collection
    ... Viral Vector Packaging Service AAV Optogenetics Viral Vector Packaging Service: Optogenetics ...Promoter Opsin Variant Tag Activity Serotype PI 20071 pACAGW-ChR2-Venus-AAV CAG ChR2 Venus Constitutive 1, 9... Page . Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...

  15. Validated gRNA Sequences

    Type
    Collection
    ...GTTGTAGCTCCCTTTCTCATTTCG 47870 cut N. meningitidis 23940360 Thomson Protospacer A Synthetic TACCATCTCAAGCTTGTTGA 48651 cut N....N. meningitidis 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48652 cut N. meningitidis...meningitidis 24076762 Church Protospacer A Synthetic TACCATCTCAAGCTTGTTGA 48653 cut S. thermophilus 24076762 Church...Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48654 cut S. thermophilus 24076762 Church Protospacer...TACCATCTCAAGCTTGTTGA 48655 cut T. denticola 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48656 cut T....

  16. Caltech Systemic Capsids

    Type
    Collection
    ... Viral Vector Packaging Service AAV Caltech Systemic Capsids Viral Vector Packaging Service: Caltech...CAP-B22 AAV9-X1.1 As part of our Viral Vector Packaging Service , Addgene is distributing ready-to-use...window) Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...

  17. Zinc Finger Consortium: Nuclease Expression Vectors

    Type
    Collection
    ...for expression of a ZFN targeted to a site with a spacer of 7 bps and harboring a “+” heterodimeric FokI...for expression of a ZFN targeted to a site with a spacer of 7 bps and harboring a “-” heterodimeric FokI...expression of a ZFN targeted to a site with a 5 or 6 bp spacer and “+” KKR heterodimeric FokI domain. ( Doyon ...expression of a ZFN targeted to a site with a 5 or 6 bp spacer and “-” ELD heterodimeric FokI domain. ( Doyon ...

  18. Serotype Testing AAV

    Type
    Collection
    ... Viral Vector Packaging Service AAV Serotype Testing AAV Viral Vector Packaging Service: Serotype ...order it? Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...

  19. Recombinases AAV Preps

    Type
    Collection
    ... Viral Vector Packaging Service AAV Recombinases Viral Vector Packaging Service: Recombinases ... Page . Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...

  20. AAV Molecular Tools

    Type
    Collection
    ... Viral Vector Packaging Service AAV Molecular Tools Viral Vector Packaging Service: Molecular Tools...6 Zhang Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...
Showing: 41 - 60 of 562 results