Skip to main content
Addgene

We narrowed to 11 results for: pac

Showing: 1 - 11 of 11 results
  1. Lentiviral Vector Guide

    Type
    Guide
    ...flanked by LTRs; 8–10 kb packaging capacity Packaging plasmid — contains packaging genes gag and pol , and...tat gene Can be packaged by both second- and third-generation packaging systems Packaging Plasmid One plasmid...isoforms of these packaging components. Therefore, lentivirus may not be efficiently packaged by gamma-retroviral...transgene and wild-type LTRs Packaging plasmid — contains entire viral genome (packaging, regulatory, and accessory...and LTRs (chimeric 5’ LTR) Packaging plasmid 1 — contains gag and pol Packaging plasmid 2 — contains rev...transfer plasmids can be packaged by either second- or third-generation packaging plasmids. For a summarized...Third-generation Transfer Plasmid Can be packaged ONLY by a second-generation packaging system that includes the tat...
  2. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...flanked by LTRs; ~8 kb packaging capacity Packaging plasmid — contains packaging genes gag and pol Envelope...of these packaging components. Therefore, gamma-retroviruses may not be efficiently packaged by lentiviral...to lentiviral packaging methods . The three plasmids described above (envelope, packaging, and transfer... . Production Using Packaging Cell Lines Gamma-retroviral vectors can be packaged using helper-free cell...envelope and packaging plasmids. Unless multiple recombination events occur between the packaging, envelope...simpler genomes, containing only the necessary packaging genes, while lentiviruses also contain accessory...lentiviruses and gamma-retroviruses use the same packaging genes. However, they are different viruses and...
  3. Adenovirus Guide

    Type
    Guide
    ...different plasmids or the packaging cell line, which not only frees up more space for genetic cargo but also...vectors and further increase the transgene packaging capacity up to ~10.5 kb. The deleted E2 and E4 regions...linearized with PacI to create a linear dsDNA construct flanked by ITRs. Cells from the packaging HEK293 or ...contain the viral gene E4, adding 2.7 kb of packaging space. However, these constructs must be transfected ...rAdV vectors can provide a large transgene packaging capacity. Large protein-coding genes and complex gene...guide RNA and other regulatory elements. The packaging capacity of rAdV vectors (~6.5 kb for first-generation...included between the ITRs is limited by the physical space available inside of the adenoviral capsid and directly...
  4. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...cell DNA synthesis but further limits the packaging capacity of rAAV vectors to ~2.4 kb. Figure 4: Examples... capsid is challenging due to its limited packaging capacity, especially if any additional regulatory ... more information. Split AAVs to increase packaging capacity Another strategy to deliver cargo too large...and References Addgene's Viral Vector Packaging Services Packaged-on-Request AAV Preps In-Stock AAV Preps...& Engelhardt, J. F. (2001). Expanding AAV packaging capacity with trans-splicing or overlapping vectors... are involved in genome replication and viral packaging. The Cap region encodes three structural capsid...origins of replication and also act as signals for packaging. Figure 1: Wild-type AAV genome. Created with ...
  5. CRISPR Guide

    Type
    Guide
    ...referred to as CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeat) technologies. Before...for Cas-binding and a user-defined ∼20-nucleotide spacer that defines the genomic target to be modified....target is present immediately adjacent to a P rotospacer A djacent M otif (PAM) The PAM sequence (NGG)... an active, DNA-binding configuration, with the spacer region of the gRNA left free to interact with the...Cas9 will only cleave a given locus if the gRNA spacer sequence shares sufficient homology with the target...throughout the genome, called off-targets, that can impact your experiment. There are many online tools available...Cas9’s interactions with DNA phosphate backbone HypaCas9 - increase Cas9 proofreading and discrimination...
  6. Plan Your Experiment

    Type
    Guide
    ...vectors is that the packaging limit (how large of a DNA sequence you can actually package into your viral ...Edit References CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeats) is a powerful system...efficiencies. The template sequences can also have a large impact on editing efficiency. So while testing multiple...promoters, and selection markers. There are also no packaging limits as there are for viral vectors — the only... Addgene's in-stock AAV preps or try Addgene's Packaged on Request service. Delivery Using mRNA and Proteins...
  7. Sequencing Primers

    Type
    Guide
    ...pBABE 5' CTTTATCCAGCCCTCAC (Weinberg Lab) Psi packaging signal, 5' of MCS in pBABE vectors, forward primer...CGCAACGATCTGGTAAACAC (Invitrogen) OpIE2 promoter, forward primer pACYC-F TGAAGTCAGCCCCATACGAT p15A origin, forward primer...
  8. Antibody Guide

    Type
    Guide
    ...antibodies are collected, tested against the antigen, packaged, and sold. This is the most cost-efficient way...antibodies to upwards of twenty. Laser and software capacity theoretically allow for roughly fifty different...
  9. Science Guides

    Type
    Guide
    ...Read More CRISPR Class 2 C lustered R egularly I nterspaced S hort P alindromic R epeat (CRISPR) systems,...
  10. Promoters

    Type
    Guide
    ...Histones are proteins found in eukaryotic cells that package DNA into nucleosomes. Histone binding prevents ...
  11. Optogenetics Guide

    Type
    Guide
    ...Description Peak Response Spectra (nm) BLUF domains bPAC Light-activated adenylyl cyclase from Beggiatoa ...
Showing: 1 - 11 of 11 results