Skip to main content
Addgene

We narrowed to 56 results for: yfp

Showing: 41 - 56 of 56 results
  1. Hot Plasmids - August 2020

    Type
    Blog Post
    ...syn-FLEX-axon-jYCaMP1s. Find these AAVs at Addgene Cre-dependent EYFP AAV in the new serotype PHP.V1 that exhibits efficient...
  2. Allen Institute for Brain Science AAV Enhancer Collection

    Type
    Collection
    ...pAAV-AiE2402m-minBG-SYFP2-WPRE3-BGHpA AiP1706 AiE2402m SYFP2 Layer 5_ET Isocortex 223981 pAAV-AiE0464m-minBG-SYFP2-WPRE3...pAAV-AiE0674m-minBG-SYFP2-WPRE3-BGHp AiP12857 AiE0674m SYFP2 Layer 5_ET Isocortex 224017 pAAV-AiE0667m-minBG-SYFP2-WPRE3...Region 230551 pAAV-AiE2638m-minBG-SYFP2-WPRE3-BGHpA AiP2105 AiE2638m SYFP2 Layer 2-3_IT Isocortex 230803 ...Isocortex 214583 pAAV-AiE2543m-minBG-SYFP2-WPRE3-BGHpA AiP1924 AiE2543m SYFP2 Layer 2-3_IT Isocortex 220727 ...Isocortex 224004 pAAV-AiE0680m-minBG-SYFP2-WPRE3-BGHpA AiP12754 AiE0680m SYFP2 Layer 2-3_IT Isocortex 230402 ...223974 pAAV-AiE0050m_3xC2-minCMV-SYFP2-WPRE3-BGHpA AiP12211 AiE0050m_3xC2 SYFP2 Layer 4_IT Isocortex 224056...224038 pAAV-AiE0671m_3xC2-minBG-SYFP2-WPRE3-BGHpA AiP13897 AiE0671m_3xC2 SYFP2 Layer 4_IT Isocortex 220734...
  3. Optogenetics AAV Preps

    Type
    Collection
    ...ET/TC)-EYFP nEF ChR2(E123T/T159C) EYFP Flp dependent 8 Deisseroth 26968 pAAV-Ef1a-DIO ChETA-EYFP EF1a ChETA...E123T/H134R)-eYFP.WPRE.hGH CaMKII ChETA EYFP Constitutive 9 Deisseroth 135633 pAAV-S5E2-C1V1-eYFP E2 C1V1 ...Arch3.3-EYFP nEF Arch3.3 EYFP Cre dependent 8 Deisseroth 137150 pAAV-nEF-Coff/Fon-Arch3.3-p2a-EYFP nEF Arch3.3...Arch3.3 EYFP Flp dependent 8 Deisseroth 20949 pAAV-double floxed-eNpHR-EYFP-WPRE-pA EF1a eNpHR EYFP Cre dependent...pAAV-CaMKIIa-eNpHR 3.0-EYFP CaMKII eNpHR 3.0 EYFP Constitutive 1, 9 Deisseroth 26972 pAAV-hSyn-eNpHR 3.0-EYFP Syn eNpHR...eNpHR 3.0 EYFP Constitutive 2, 5 Deisseroth 137151 pAAV-nEF-NpHR3.3-EYFP nEF NpHR 3.3 EYFP Constitutive...NpHR3.3-EYFP nEF NpHR 3.3 EYFP Cre dependent 8 Deisseroth 137154 pAAV-nEF-Coff/Fon-NpHR3.3-EYFP nEF NpHR...
  4. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...H134R)-eYFP.WPRE.hGH Optogenetics Karl Deisseroth AV-1-26968P 26968-AAV1 pAAV-Ef1a-DIO ChETA-EYFP Optogenetics...pAAV-CaMKIIa-hChR2(H134R)-EYFP Optogenetics Karl Deisseroth AV-1-26971P 26971-AAV1 pAAV-CaMKIIa-eNpHR 3.0-EYFP Optogenetics...eNpHR 3.0-EYFP Optogenetics Karl Deisseroth AV-5-26968P 26968-AAV5 pAAV-Ef1a-DIO ChETA-EYFP Optogenetics...pAAV-CaMKIIa-hChR2(H134R)-EYFP Optogenetics Karl Deisseroth AV-5-26972P 26972-AAV5 pAAV-hSyn-eNpHR 3.0-EYFP Optogenetics...floxed-eNpHR-EYFP-WPRE-pA Optogenetics Karl Deisseroth AV-9-26966P 26966-AAV9 pAAV-Ef1a-DIO eNpHR 3.0-EYFP Optogenetics...H134R)-eYFP.WPRE.hGH Optogenetics Karl Deisseroth AV-9-26968P 26968-AAV9 pAAV-Ef1a-DIO ChETA-EYFP Optogenetics...pAAV-CaMKIIa-hChR2(H134R)-EYFP Optogenetics Karl Deisseroth AV-9-26971P 26971-AAV9 pAAV-CaMKIIa-eNpHR 3.0-EYFP Optogenetics...
  5. Deisseroth INTRSECT Collection

    Type
    Collection
    ...proof-of-concept targeting approach in 2014 1 (using EYFP and ChR2-EYFP as payloads). This approach has been broadly...constructs experimentally. Plasmids In addition to EYFP and ChR2-EYFP, a large number of additional, validated ...Items 55641 pAAV-Ef1a-fDIO EYFP Flp Yes 55640 pAAV-Ef1a-dDIO hChR2(H134R)-EYFP Dre No 55639 pAAV-Ef1a-fDIO...pAAV-Ef1a-fDIO hChR2(H134R)-EYFP Flp Yes 126080 pAAV-Ef1a-sCreDIO hChR2(H134R)-eYFP Scre No 126081 pAAV-Ef1a-vCreDIO...Items 55650 pAAV-hSyn Con/Fon EYFP Cre AND Flp Yes 231926 pAAV-Ef1a-Con/Fon-EYFP Cre AND Flp No 55651 pAAV-hSyn...pAAV-hSyn Con/Foff EYFP Cre AND NOT Flp F3/F5 No 137162 pAAV-Ef1a-Con/Foff 2.0-EYFP Cre AND NOT Flp FRT/...55652 pAAV-hSyn Coff/Fon EYFP Flp AND NOT Cre No 231927 pAAV-Ef1a-Coff/Fon-EYFP Flp AND NOT Cre Yes 137129...
  6. Caltech Systemic Capsids

    Type
    Collection
    ...rAAV-DLX2.0-minBG-SYFP2-WPRE3-BGHpA minBetaGlobin SYFP2 Control Ting 163509 CN1839-rAAV-hSyn1-SYFP2-10aa-H2B-WPRE3...Dlx mRuby2 Control Gradinaru 104055 pAAV-CAG-eYFP CAG EYFP Control Gradinaru 104061 CAG-NLS-GFP CAG NLS-GFP...EF1a mCherry Control Deisseroth 117382 hSyn1-eYFP Syn EYFP Control Gradinaru 135630 pAAV-S5E2-dTom-nlsdTom...-BGHpA hSyn1 H2B-SYFP2 Control Ting 191706 AiP13044 - pAAV-AiE0779m_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias...: CN3044) minBG SYFP2 Control AIBS , Ting 191707 AiP12237 - pAAV-AiE0452h-minBG-SYFP2-WPRE3-BGHpA (Alias... - pAAV-AiE0743m_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3038) minBG SYFP2 Control AIBS , Ting 191726 AiP12787... - pAAV-AiE0140h_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2787) minBG SYFP2 Control AIBS , Ting 191728 AiP12408...
  7. Brain Initiative Collection

    Type
    Collection
    ...-CAG-DIO-EYFP An AAV genome encoding Cre-dependent expression of the fluorescent protein EYFP from the...AAV2 pAAV-CAG-eYFP An AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG ...AAV5 pAAV-CAG-eYFP An AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG ...AAVrg pAAV-CAG-eYFP An AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG ...PHPeB pAAV-CAG-eYFP An AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG ...Boyden 117382-AAV2 hSyn1-eYFP An AAV genome that expresses the fluorescent protein eYFP from the hSyn1 promoter...Gradinaru 117382-AAV5 hSyn1-eYFP An AAV genome that expresses the fluorescent protein eYFP from the hSyn1 promoter...
  8. Brain Armamentarium

    Type
    Collection
    ...pAAV-AiE0873m_3xC2-minBG-SYFP2-P2A-3XFLAG-10aa-H2B-WPRE3-BGHpA (Alias: CN4496) Expression of SYFP2 (yellow fluorescent...-minBG-ChR2(H134R)-EYFP-WPRE3-BGHpA (Alias: CN3755) Expression of ChR2(H134R)-EYFP in striatal cholinergic...pAAV-AiE0441h_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3905) Enhancer AAV for expression of SYFP2 in all striatal...pAAV-AiE0888m_C4-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3863) Enhancer AAV for expression of SYFP2 in midbrain dopamine...AiP12610 - pAAV-AiE0780m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2610) Expression of SYFP2 (yellow fluorescent protein...AiP12408 - pAAV-AiE0600m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2408) Expression of SYFP2 (yellow fluorescent protein...pAAV-AiE0140h_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2787) Expression of SYFP2 (yellow fluorescent protein...
  9. Control AAV Preps

    Type
    Collection
    ... EGFP Constitutive 5 Haydon 104055 pAAV-CAG-eYFP CAG EYFP Constitutive 2, 5, rg*, PHP.eB Gradinaru 104061...Constitutive 5 Khakh 105622 pAAV.CamKII(1.3).eYFP.WPRE.hGH CamKII(1.3) eYFP Constitutive 1 Deisseroth 105921 pAAV-CBh-mKate2... 1, 2, 5, 8, 9, rg* Deisseroth 117382 hSyn1-eYFP hSyn eYFP Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB Gradinaru...Constitutive 1 Piatkevich 27056 pAAV-Ef1a-DIO EYFP EF1a EYFP Cre dependent 1, 2, 5, 9, rg* Deisseroth 28306... dependent 1 Wickersham 104052 pAAV-CAG-DIO-EYFP CAG EYFP Cre dependent PHP.V1 Gradinaru 83895 pAAV-hDlx-Flex-GFP-Fishell... 8 Deisseroth 137162 pAAV-Ef1a-Con/Foff 2.0-EYFP EF1a EYFP Cre dependent 8 Deisseroth 98927 pENN.AAV.CAG.Flex.GFPsm_myc.WPRE.SV40..., 8, 9, rg* Deisseroth 55641 pAAV-Ef1a-fDIO EYFP EF1a EYFP Flp dependent 1, 2, 5, 8, 9, rg* Deisseroth...
  10. Retrograde AAV viral preps

    Type
    Collection
    ...pAAV-Ef1a-DIO EYFP EF1a EYFP, Cre-dependent Control Deisseroth 55641 pAAV-Ef1a-fDIO EYFP EF1a EYFP, Flp-dependent...Fon/Von eYFP nEF EYFP, Cre, Flp and VCre-dependent Control Deisseroth 117382 hSyn1-eYFP Syn EYFP Control...Cre-dependent Control Roth 55650 pAAV-hSyn Con/Fon EYFP Syn EYFP, Cre and Flp-dependent Control Deisseroth 28306...Dlx dTomato Control Fishell 104055 pAAV-CAG-eYFP CAG EYFP Control Gradinaru 112677 pOTTC1032 - pAAV EF1a... 3.0-EYFP EF1a Inhibitor, Cre-dependent Optogenetics Deisseroth 26973 pAAV-hSyn-hChR2(H134R)-EYFP Syn ...(H134R)-EYFP EF1a Activator Optogenetics Deisseroth 55645 pAAV-hSyn Con/Fon hChR2(H134R)-EYFP Syn Activator...Deisseroth 20298 pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA EF1a Activator, Cre-dependent Optogenetics...
  11. Fluorescent Protein Guide: FRET

    Type
    Collection
    ...C-terminal His tag SYFP2 Yellow Mammalian Express a gene of interest fused to the C-terminus of SYFP2 Clover Green... EYFP connected by 8 GGSGGS repeats pET28CLY9 Peptide linker standard consisting of ECFP and EYFP connected...pET28CLY1 Peptide linker standard consisting of ECFP and EYFP connected by 1 flexible glycine- and serine-containing...pET28CLY2 Peptide linker standard consisting of ECFP and EYFP connected by 2 GGSGGS repeats pET28CLY3 Peptide ...Peptide linker standard consisting of ECFP and EYFP connected by 3 GGSGGS repeats pET28CLY4 Peptide linker standard... standard consisting of ECFP and EYFP connected by 4 GGSGGS repeats pET28CLY5 Peptide linker standard ...standard consisting of ECFP and EYFP connected by 5 GGSGGS repeats pET28CLY6 Peptide linker standard consisting...
  12. Sequencing Primers

    Type
    Guide
    ...Golenbock lab) For distinguishing EGFP vs ECFP vs EYFP, reverse primer F1ori-F GTGGACTCTTGTTCCAAACTGG F1...
  13. AAV Molecular Tools

    Type
    Collection
    ...TRE-DIO-eYFP Cre-dependent and Tetracycline-inducible Cre-dependent, Tet-inducible expression of EYFP 1 Gradinaru...
  14. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...Llama 135219 HS22 pEYFPN1 anti-Homer1 nanobody HS22 Homer1 Mouse Llama 135220 HC20 pEYFPN1 anti-Homer1 nanobody...Llama 135221 HS38 pEYFPN1 anti-Homer1 nanobody HS38 Homer1 Mouse Llama 135223 HC87 pEYFPN1 anti-Homer1 nanobody...
Showing: 41 - 56 of 56 results