We narrowed to 591 results for: ARL
-
TypeGuide...CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT...CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer CRE-R GCAAACGGACAGAAGCATTT...primer pLTet-F ACTGAGCACATCAGCAGGAC Lambda phage early leftward (pL) promoter, forward primer pLXSN 5' ...pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV major immediate-early protein (IE), forward primer pMT2-F TTGCCTTTCTCTCCACAGGT...
-
CRISPR Guide
TypeGuide...techniques are referred to as CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeat) technologies...AcrVA3.1, which inhibits both Cas12a and Cas3. Similarly, some Acr proteins are specific to a particular...editors are based on cytosine base editors and similarly work by first converting cytidine to uridine. ...with the sequence, so the edit is not considered “scarless”. Figure 7: Overview of CRISPR transposases Browse...by cutting only one strand CRISPR C lustered R egularly I nterspaced S hort P alindromic R epeat, a bacterial... Yang, L., Esvelt, K. M., Aach, J., Guell, M., DiCarlo, J. E., Norville, J. E., & Church, G. M. (2013)... -
Plan Your Experiment
TypeGuide... Genetic Edit References CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeats) is ...from the mRNA due to alternative splicing, and an early frameshift mutation is more likely to result in ...experiments, testing multiple pegRNA designs is particularly important for prime editing. CRISPR Intereference... -
Chemogenetics Guide
TypeGuide...Chemogenetics Guide Jump To: Chemogenetics Guide Early Chemogenetic Receptors: RASSLs DREADDs PSAMs LMOs...General overview of a chemogenetics experiment. Early Chemogenetic Receptors: RASSLs The first chemogenetic... -
Optogenetics Guide
TypeGuide...and light oxygen voltage (LOV) domains function similarly to cryptochromes with light-induced changes in...Synthetic Neurobiology Group Optogenetics Resources Karl Deisseroth's Lab: Optogenetics Resource Center Boyden... -
Molecular Biology Reference
TypeGuide...of phenotypic information was introduced in the early 19th century by Gregor Mendel, who later demonstrated...clones of the original cell. The plasmid DNA is similarly referred to as cloned DNA, and this process of... -
Adeno-associated virus (AAV) Guide
TypeGuide...viral genome. Helper plasmid E4 in trans Adenoviral early gene that encodes for proteins essential for AAV...replication and packaging. E2A in trans Adenoviral early gene that encodes a DNA-binding protein (DBP) that... -
Science Guides
TypeGuide...activity. Read More CRISPR Class 2 C lustered R egularly I nterspaced S hort P alindromic R epeat (CRISPR... -
Modular Cloning Guide
TypeGuide...Bacterial Expression, Fungal Expression Nili Ostrov , Charlie Gilbert , and Cultivarium Tools 189 plasmids, including... -
Gamma-Retroviral Vector Guide
TypeGuide...antigen receptor T cell (CAR-T) therapy is a particularly popular application of gamma-retroviral vectors... -
Lentiviral Vector Guide
TypeGuide...delivery of gene therapies. Lentiviral vectors are particularly effective for stem cell therapies, which rely...