Skip to main content

We narrowed to 602 results for: ARL

Showing: 581 - 600 of 602 results
  1. Typing CRISPR Systems

    Type
    Blog Post
    ...about 90% of identified CRISPR-Cas in bacteria and nearly 100% in archaea, though Class 1 remains largely...
  2. Adenovirus Guide

    Type
    Guide
    ... divided into early (E1A, E1B, E2, E3, E4) and late (L1, L2, L3, L4, L5) regions. Early transcripts are...5 (Ad5) and have been produced by replacing the early and late adenoviral transcript regions between the...rAdV vectors, as well as the deletion of the other early gene regions, E2 and E4. These modifications aimed... when administered in vivo, however deletion of early genes also resulted in a reduction of viral vector...Adenoviral plasmid E2A, E2B, E3, E4 in trans Adenoviral early transcript regions involved in viral DNA replication...
  3. CRISPR Guide

    Type
    Guide
    ...techniques are referred to as CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeat) technologies...AcrVA3.1, which inhibits both Cas12a and Cas3. Similarly, some Acr proteins are specific to a particular...editors are based on cytosine base editors and similarly work by first converting cytidine to uridine. ...with the sequence, so the edit is not considered “scarless”. Figure 7: Overview of CRISPR transposases. Browse...by cutting only one strand CRISPR C lustered R egularly I nterspaced S hort P alindromic R epeat, a bacterial... Yang, L., Esvelt, K. M., Aach, J., Guell, M., DiCarlo, J. E., Norville, J. E., & Church, G. M. (2013)...
  4. Sequencing Primers

    Type
    Guide
    ...Forward CGCAAATGGGCGGTAGGCGTG Human CMV immediate early promoter Forward EGFP-C CATGGTCCTGCTGGAGTTCGTG 3...Forward CGCAAATGGGCGGTAGGCGTG Human CMV immediate early promoter Forward CRE-R GCAAACGGACAGAAGCATTT 5' end...Reverse pLTet-F ACTGAGCACATCAGCAGGAC Lambda phage early leftward (pL) promoter Forward pLXSN 5' (MSCV) CCCTTGAACCTCCTCGTTCGACC...pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV major immediate-early protein (IE) Forward pMT2-F TTGCCTTTCTCTCCACAGGT...
  5. Plan Your Experiment

    Type
    Guide
    ... Genetic Edit References CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeats) is ...from the mRNA due to alternative splicing, and an early frameshift mutation is more likely to result in ...experiments, testing multiple pegRNA designs is particularly important for prime editing. CRISPR Intereference...
  6. Chemogenetics Guide

    Type
    Guide
    ...Chemogenetics Guide Jump To: Chemogenetics Guide Early Chemogenetic Receptors: RASSLs DREADDs PSAMs LMOs...General overview of a chemogenetics experiment. Early Chemogenetic Receptors: RASSLs The first chemogenetic...
  7. Molecular Biology Reference

    Type
    Guide
    ...of phenotypic information was introduced in the early 19th century by Gregor Mendel, who later demonstrated...information as the parental cell. The plasmid DNA is similarly referred to as cloned DNA, and this process of...
  8. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...viral genome. Helper plasmid E4 in trans Adenoviral early gene that encodes for proteins essential for AAV...replication and packaging. E2A in trans Adenoviral early gene that encodes a DNA-binding protein (DBP) that...
  9. Science Guides

    Type
    Guide
    ...activity. Read More CRISPR Class 2 C lustered R egularly I nterspaced S hort P alindromic R epeat (CRISPR...
  10. Promoters

    Type
    Guide
    ... Mammalian Strong hybrid promoter; contains CMV early enhancer element and the chicken beta-actin promoter...
  11. Modular Cloning Guide

    Type
    Guide
    ...Bacterial Expression, Fungal Expression Nili Ostrov , Charlie Gilbert , and Cultivarium Tools 189 plasmids, including...
  12. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...antigen receptor T cell (CAR-T) therapy is a particularly popular application of gamma-retroviral vectors...
Showing: 581 - 600 of 602 results