We narrowed to 747 results for: cat.1

...therapies to clinical trials in 2021. Figure 1: Schematic of the human MECP2 locus and MECP2 protein...detrimental as too little, resulting in MECP2 duplication syndrome or Rett Syndrome, respectively. One ...Efficient and Precise CRISPR/Cas9-Mediated MECP2 Modifications in Human-Induced Pluripotent Stem Cells. Front..., Hector RD, Cobb SR, Bird A (2017) Radically truncated MeCP2 rescues Rett syndrome-like neurological ...

...complex. So how exactly does this work? Figure 1: APOBEC- and Cas9-mediated editing (ACE) reporter ...2019). TREE is a real-time, fluorescent based identification system for the isolation of base-edited cell...to BFP Conversion: A Versatile Assay for the Quantification of CRISPR/Cas9-mediated Genome Editing. Molecular...Harris RS (2018) A fluorescent reporter for quantification and enrichment of DNA editing by APOBEC–Cas9...

...Addgene's Chemogenetics Plasmid Collection . Figure 1: General overview of a chemogenetics experiment. Early...bidirectional control of neuronal activity. Table 1: Descriptions of DREADDs and their activity in neurons... while PSAMs and LMOs have an effect for only 0.5–1 hours after delivery. Chemogenetic Ligand The chemogenetic...Causal Cellular and Neuronal Biology. Physiol Rev, 98 (1), 391–418. https://doi.org/10.1152/physrev.00009.2017...Neurophotonics 11 (2), 021005. https://doi.org/10.1117/1.NPh.11.2.021005 PMID: 38450294 Coward, P., Wada, H... Gi-coupled receptor. Proc Natl Acad Sci USA, 95 (1), 352–357. https://doi.org/10.1073/pnas.95.1.352 PMID... 451–460. https://doi.org/10.1007/s00213-004-2017-1 PMID: 15765260 Farrell, M. S., Pei, Y., Wan, Y., Yadav...

...typically ranges from 8–10 kb, encoded on RNA (Figure 1). This RNA is reverse transcribed into the provirus...been removed or mutated for increased safety. Figure 1: Wild-type lentivirus genome. Created with BioRender.com...genes (for example, vif , vpr , vpu , and nef for HIV-1). The LTRs flank all of these genes, and anything ...transgene and LTRs (chimeric 5’ LTR) Packaging plasmid 1 — contains gag and pol Packaging plasmid 2 — contains...and third-generation systems, please refer to Table 1. Figure 4: Third-generation lentiviral plasmids. Created...heterologous enhancer/promoter such as CMV or RSV Table 1. Summary of key differences between second- and third-generation...More Lentiviral Vector topics Addgene Protocols pLKO.1 - TRC Cloning Vector Protocols Lentiviral Vector Production...

...conference for any reason was a Singleton. Figure 1: The Binning Singletons logo. Image: James et al.,... written up in mSphere. A post-meeting survey indicated that the program was largely a success, but also...

...and biotin plasmids at Addgene!     Figure 1: Indirect detection of target markers can be achieved...labeling can be subdivided into two categories, depending on the location of the targeted markers. Some commercially...proteins, such as receptors, or post-translational modifications on those proteins, like glycosylation patterns...Depending on the research question and downstream application, one or several of those techniques can be used...your flow analysis. However, certain downstream applications, like an in vivo adoptive transfer of those ...labeling Oftentimes, a marker of interest is not located on the cell membrane but inside the cell. Due to...but preserving the cellular state (think of mummification). Permeabilization, as the name suggests, perforates...

...’re not one of these people yourself.  Fig 1: Quote from Michael Ende, courtesy of morefamousquotes.com...conflict is not always what was communicated but how it was communicated. The next step is to come up with...of lapsed communication. Making some assumptions about how something should be communicated is necessary...skill in and of itself. Conflict can also be categorized as either “personal” or “substantive”. A personality-based...traced back to one of a few trouble spots:  Communication (or lack thereof): Information sharing gets ...organization gets, and creating new avenues of communication can create as many problems as it can solve....meeting? Different teams frequently prefer to communicate in different ways, so the source of the conflict...

...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward M13 Forward...TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region Reverse CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol ...LacZ Reverse LexA CGTCAGCAGAGCTTCACCATTG 3' end of LexA DNA binding domain Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT... GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter... plasmid verification, Addgene has used a number of primers for Sanger sequence verification over the ... AC5 ACACAAAGCCGCTCCATCAG Drosophila Actin 5C promoer Forward Alpha-factor TACTATTGCCAGCATTGCTGC Alpha...Bglob-intron-F CTGGTCATCATCCTGCCTTT Rabbit beta-globin intron Forward Bglob-intron-R TTTGCCCCCTCCATATAACA Rabbit...

...gene, and a terminator, as in Figure 1). Next, up to six Level 1 modules can be assembled into a Level...consists of three sets of cloning vectors (Level 0, 1, and 2) which can be used in successive assembly steps... 0 parts are directionally assembled into a Level 1 vector creating a single transcriptional unit (for...maintain the final plasmid after transformation. Figure 1: Overview of the MoClo Toolkit components and assembly...protein purification tags and fluorescence proteins for use in E. coli for a variety of applications. EcoFlex...Modular Cloning Blog: Plasmids 101 Modular Cloning Applications and Kits Blog: Plasmids 101 Golden Gate Cloning... between. MoClo can be used for a variety of applications—like building synthetic genetic circuits, engineering...

...editing efficiency and fidelity. Nature Communications , 13 (1), 1425. PMID: 35301321 Edraki, A., Mir,... DNA interrogation by SpRY-Cas9. Nature Communications , 15 (1), 3663. PMID: 38688943 Hsu, P. D., Scott...CRISPR-Cas9 to increase its specificity. Nature Communications , 9 (1). PMID: 30082838 Maddalo, D., Manchado, ...with an engineered chimeric Cas9. Nature Communications , 14 (1), 6175. PMID: 37794046 Small precision ...integration by homology-dependent repair. Nature Communications . 9 (1), 1133. PMID: 29556040 Chen, P. J., Hussmann...transcriptional reprogramming in bacteria. Nature Communications . 9 (1), 2489. PMID: 29950558 Fujita, T., & Fujii.... Biochemical and Biophysical Research Communications . 439 (1), 132–136. PMID: 23942116 Gilbert, L. A...

... filters. Figure 1: Contamination! Tissue culture media often have indicators included in the media... difficult to eradicate. You can suppress the growth of mycoplasma but cannot eradicate it completely....important to prevent contamination rather than eradicating it later. Don’t be scared when mycoplasma infects...the first person to face this kind of problem. Educate others when you can and help them understand the...Cc, Drexler Hg (2002) Comparative Antibiotic Eradication of Mycoplasma Infections from Continuous Cell...

.... Channelrhodopsin-1 (ChR1) is excited by blue light and permits nonspecific cation influx into the cell...based on the LOV2 domain of Avena sativa phototropin 1 LOVETRAP reversibly sequester and release proteins...diversifying and extending optogenetics. Cell, 141 (1), 154–165. https://doi.org/10.1016/j.cell.2010.02.037...limitations and future developments. Exp Physiol, 96 (1), 19–25. https://doi.org/10.1113/expphysiol.2009.051961...Biol, 1408 , 141–165. https://doi.org/10.1007/978-1-4939-3512-3_10 PMID: 26965121 Yizhar, O., Fenno, L...Channelrhodopsins: cation channels from Chlamydomonas reinhardtii ChR2 Widely used light-gated cation channel from...light of the correct wavelength, the pore opens, cations flow into the cell (yellow dots), and the neuron...

... or coding strand of the transcribed gene (Figure 1). The coding strand is the DNA strand that encodes...that is transcribed by the RNA polymerase. Figure 1: Simplified promoter region during transcription. ...Mammalian Strong promoter from human elongation factor 1 alpha PGK Constitutive Mammalian Promoter from phospholycerate... Educational Resources Molecular Biology Reference Promoters...BioRender.com. DNA sequences called response elements are located within promoter regions, and they provide a stable...Promoters in bacteria contain two short DNA sequences located at the -10 (10 bp 5' or upstream) and -35 positions... (TSS) (Figure 2). The Pribnow box (TATAAT) is located at the -10 position and is essential for transcription...

...halorhodopsins to silence neuronal activity (Figure 1) (Wiegert et al., 2017). How to get an opsin into...and Jinfang Zhu. "Immunologic applications of conditional gene modification technology in the mouse." Current...contributed by Alessia Armezzani, scientific communication manager at genOway. A few decades ago, the brain...École Normale Supérieure de Lyon. Her love for educational science led her to pursue a teaching career, ..., and she now is a very happy scientific communication manager at genOway.     Acknowledgement:Through...Bacteriophage P1 site-specific recombination. Purification and properties of the Cre recombinase protein...): 7025-7030. PubMed PMID: 18614669. Belzung, Catherine, Marc Turiault, and Guy Griebel. "Optogenetics...

...Bachelor's degree Generally a short-term position (1-2 years) Often a gap-year position taken to transition...entire page dedicated to different career options from science policy to science communication and much ...), about their experiences. Research requires dedication and effort, so building a strong understanding...critically about whether it’s something you want to dedicate your time and energy to. How can I make the most... feel less confident in their abilities and qualifications. Studies on imposter syndrome have also found...universities often have scholarships and funds dedicated for undergraduates interested in doing research...the experience would improve my scientific and application writing skills, and ended up with the award. ...

...experience in cancer research After graduating with a 2:1 BSc in Molecular Biology (roughly a B average in the...at the Institute of Cancer Research in Sutton, located on the edge of London to gain relevant experience...recession. As each advertised job received many applications, employers were requesting that only scientists...commercial company. In my particular situation, communication between departments was sometimes difficult ... order to have meetings between teams. This communication is vital because otherwise I’d lose touch with...

... serve as origins of replication and also act as signals for packaging. Figure 1: Wild-type AAV genome...tissue tropism. Table 1 gives a summary of the tropism of AAV serotypes, indicating different serotype(s...AAV5, AAV8 Skeletal muscle AAV1, AAV8, AAV9 Table 1: Summary of tissue tropism displayed by different ...transgene, but also at a very low efficiency (less than 1% of wild-type). Another split AAV method which has...vectors pseudotyped with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell...potential formation of replication-competent viruses. While AAV themselves are replication incompetent, there...production of replication-competent viruses that would be able to infect cells and replicate autonomously...

...enzyme and guide RNA) for your experiment (Figure 1). You will decide how to express Cas9, the delivery...finally how to validate your genetic edit. Figure 1: Flow chart describing the general framework of a ...population. Some cells may remain wild type due to either (1) a lack of gRNA and/or Cas9 expression or (2) a lack...Biology , 1239 , 197–217. https://doi.org/10.1007/978-1-4939-1862-1_10 PMID: 25408407 Dixit, A., Parnas, O...Achieving your desired edit comes down to location, location, location. Positioning your chosen Cas enzyme ...designing the gRNA component for each category. Genetic Manipulation Application Cas Enzyme Additional Considerations...the table below, we highlight the most common categories of genetic manipulations used in mammalian cells...

... DNA fragments of interest, such as genes. Figure 1: Creation of recombinant DNA. Working with Plasmids...U169 recA1 endA1 hsdR17(rk-, mk+) phoA supE44 thi-1 gyrA96 relA1 tonA EPI300 LGC Biosearch Technologies...Addgene; Promega e14-(McrA-) recA1 endA1 gyrA96 thi-1 hsdR17(rK- mK+) supE44 relA1 Δ(lac- proAB) [F traΔ36...galK2 lacY1 proA2 rpsL20 (StrR ) xyl-5 λ- leu mtl-1 Top10 Invitrogen F- mcrA Δ(mrr-hsdRMS-mcrBC) Phi80lacZM15...Origin of Replication ( ori ) DNA sequence which directs the initiation of plasmid replication in bacteria... not located elsewhere in the plasmid backbone. In expression plasmids, the MCS is often located downstream...advantage of the process of DNA replication in vitro. During replication, the DNA helix is unwound by a...

...gamma-retroviruses ranges from 9–11 kb, encoded on RNA (Figure 1). This RNA is reverse transcribed into the provirus...producing viral vectors in a laboratory setting. Figure 1: Wild-type gamma-retrovirus genome. Created with BioRender.com...and tropism. Replication-competent The ability of a virus (or viral vector) to replicate and reproduce...hosts in order to continue their lifecycle and replicate. This feature can be harnessed for stable delivery... for safety to reduce the chance of creating replication-competent retroviruses. For a summary of all ... gamma-retroviral vectors integrate at random locations throughout the genome. Gamma-retroviral vectors...retroviral vectors are commonly used in gene therapy applications to more specifically direct delivery of gene...