We narrowed to 83 results for: Apoe
-
TypeBlog Post...considering for your experiment, note that you cannot extrapolate results from one cell type to another, as they...
-
A History of Genome Engineering in Popular Culture
TypeBlog Post...what would happen if these corporations would extrapolate genetic engineering to exploit human beings. ... -
Cancer and the Immune System: Deciphering the Relationship
TypeBlog Post...them are a few methodologies being researched. Apoptotic and necroptotic tumor cells have also been tested... -
Antibodies 101: Flow Cytometry
TypeBlog Post...permeabilization with detergents such as triton-x, saponin, or tween. Take care when using strong detergents... -
Water Bath Protocol
TypeProtocol...on the surfaces of the water bath as the water evaporates from the tub. Disinfectant may be added to prevent...cover on the top of the water bath to prevent evaporation and maintain the desired temperature. This also... -
Deep Dive: qPCR
TypeBlog Post...configurations can help you identify pipetting or evaporation errors. And if time allows, you can fit in a ... -
CRISPR Plasmids - Base Edit
TypeCollection...dead” Cas9 (dCas9) to a cytidine deaminase like APOBEC. Base editors are targeted to a specific locus ... -
Antibody Validation Using the Indirect ELISA Method
TypeProtocol...well ventilated area and avoid breathing in the vapors. Workflow Timeline Day 1: Antigen Coating Day 2...Desmin (blue) or a negative control protein, Apolipoprotein L3 (red) overnight, blocked, and incubated ... -
CRISPR Methods for Bacteria: Genome Engineering, CRISPRa, CRISPRi, Base Editing, and More
TypeBlog Post...Chen et al., 2018). Using the cytidine deaminase, APOBEC1 and a nickase version of Cas9 they were effectively... -
mTOR Pathway
TypeCollection...the presence of both pro-proliferative and anti-apoptotic signals. mTORC2, which appears to signal upstream... -
22 Hot Plasmid Technologies from 2014
TypeBlog Post...AAV expression vectors for certain variants. Klapoetke et al., Nat Methods 2014 Mar 11;(3):338-46. ... -
CRISPR Pooled gRNA Libraries
TypeCollection...tuberculosis M. smegmatis Green monkey ( C. sabaeus ) Kaposi's Sarcoma-associated Herpes Virus (KSHV) Cow ( B... -
Allen Institute for Brain Science AAV Enhancer Collection
TypeCollection...Gore, B. B., Weed, N., Omstead, V., Bishaw, Y., Shapovalova, N. V., Martinez, R. A., Fong, O., Yao, S., Mortrud... -
Validated gRNA Sequences
TypeCollection...GAAGCGGGCAAAGGGGCGAC 58780 cut/nick S. pyogenes 24954249 Yamamoto apoea D. rerio GGATGAGCCAAGAAGCCGCT 42241 cut S. pyogenes... -
27 Hot Plasmids from 2016
TypeBlog Post...processes such as differentiation, proliferation, and apoptosis. In humans, mutations that permanently activate... -
Trimmer Lab NeuroMab Collection
TypeCollection...IgG2a 188214 Anti-GST [N100/13R ] GST Schistosoma japonicum Mouse IgG2a 188215 Anti-TrpC7 [N64A/36R ] TrpC7...GST scFv [N100/13] N100/13 scFv GST Schistosoma japonicum Mouse 190522 Aldh1L1 scFv [N103/31] N103/31 scFv... -
Protocol - How to Run an Agarose Gel
TypeProtocol...overboil the solution, as some of the buffer will evaporate and thus alter the final percentage of agarose... -
AAV Titration by qPCR Using SYBR Green Technology
TypeProtocol...of causes, such as pipetting error and sample evaporation. Make the master mix after all the samples have... -
Western Blot
TypeProtocol...BSA standard concentration versus absorbance. Extrapolate the total protein concentration of the sample... -
CRISPR Guide
TypeCollection...nickase (Cas9n) or dCas9 to a cytidine deaminase like APOBEC. Within the region of single-stranded DNA created...