We narrowed to 13 results for: Apoe
-
TypeCollection...pGL3Basic_ME.1/ApoEpromoter APOE ApoE Alzheimer's Sohail Tavazoie 51436 pGL3Basic-ME.2/ApoEpromoter APOE ApoE Alzheimer's...190810 FUGW-APOE-E4-T2A-Puro APOE UbC Alzheimer's Ronald Hart 190811 pTet-O-APOE-E2-T2A-Puro APOE UbC Alzheimer's... pTet-O-APOE-E3-T2A-Puro APOE UbC Alzheimer's Ronald Hart 190813 pTet-O-APOE-E4-T2A-Puro APOE UbC Alzheimer's...190807 FUGW-APOE-E2-T2A-mCherry APOE mCherry UbC Alzheimer's Ronald Hart 190808 FUGW-APOE-E3-T2A-mCherry...T2A-mCherry APOE mCherry UbC Alzheimer's Ronald Hart 190809 FUGW-APOE-E4-T2A-mCherry APOE mCherry UbC Alzheimer's...41846 psiCheck-ApoE3'UTR APOE SV40 Alzheimer's Sohail Tavazoie 41848 psiCheck-ApoECDS APOE Luc SV40 Alzheimer's...Schwamborn 87085 pCMV4-ApoE2 APOE CMV Alzheimer's Bradley Hyman 87086 pCMV4-ApoE3 APOE CMV Alzheimer's Bradley...
-
Neurodegeneration Research Collection
TypeCollection...environmental factors. For example, variations of Apolipoprotein E (APOE), such as the ε4 allele, are a risk factor... -
Immunology Research Plasmids and Resources
TypeCollection...necrosis factor (ligand) superfamily, member 10 APO2L, Apo-2L, CD253, TL2, TRAIL TNFSF11 tumor necrosis ...necrosis factor (ligand) superfamily, member 10 APO2L, Apo-2L, CD253, TL2, TRAIL TYROBP TYRO protein tyrosine... necrosis factor receptor superfamily, member 25 APO-3, DDR3, DR3, LARD, TNFRSF12, TR3, TRAMP, WSL-1, ...Fas (TNF receptor superfamily, member 6) ALPS1A, APO-1, APT1, CD95, FAS1, FASTM, TNFRSF6 FASLG Fas ligand...involved in proliferation, cell differentiation, and apoptosis. Plasmid Tables The gene names in these tables... -
p53 Pathway
TypeCollection...agonist CASP3 Caspase 3, apoptosis-related cysteine peptidase CASP8 Caspase 8, apoptosis-related cysteine peptidase...effects of p53 are in promoting cell cycle arrest, apoptosis, or senescence in damaged cells. The p53 name ...oligomerization. In particular, the loss of p53’s pro-apoptotic effects is especially important to tumorigenesis... below. Symbol Name 14-3-3-σ Stratifin Apaf-1 Apoptotic peptidase activating factor 1 ATM ATM serine/threonine...peptidase CASP9 Caspase 9, apoptosis-related cysteine peptidase Cyclin B CCNB1 CCNB2 CCNB3 Cyclin B1, ...protein p53 p53AIP1 Tumor protein p53 regulated apoptosis inducing protein 1 p53R2 p53 inducible, ribonucleotide...activator inhibitor type 1), member 1 PERP TP53 apoptosis effector PIDD p53-induced death domain protein... -
TALENs for Endogenous Zebrafish Genes
TypeCollection...TCCCGTCTCTGGCCATGAcctcctctaatggatcTCATTCCAACGGTGTGCA apoa4 TAL3022 & TAL3025 TGGCAGGACCAACCAATGcccagcatggacctggTGAAAAATGCTTTCTGGA apoa4-like TAL3023...TGAAGGTTCTTGTGGTGCtcacacttgctgtggtTACAGGTAAGAAACTAAA apoeb TAL3402 & TAL3403 TGCCAGGCTCGTAGCCTGttccaggctgatgccccTCAGCCCAGATGGGAGGA... -
Zinc Finger Consortium: Zinc Finger Arrays
TypeCollection...OZ528 OPEN OPEN cACCCTCCTCgtggtGCTGGTGGCc apoeb (apolipoprotein Eb) OZ529 and OZ530 OPEN OPEN gCCCCTCAGCccagatgGGAGGAGATg... -
CRISPR Plasmids - Base Edit
TypeCollection...dead” Cas9 (dCas9) to a cytidine deaminase like APOBEC. Base editors are targeted to a specific locus ... -
mTOR Pathway
TypeCollection...the presence of both pro-proliferative and anti-apoptotic signals. mTORC2, which appears to signal upstream... -
CRISPR Pooled gRNA Libraries
TypeCollection...tuberculosis M. smegmatis Green monkey ( C. sabaeus ) Kaposi's Sarcoma-associated Herpes Virus (KSHV) Cow ( B... -
Allen Institute for Brain Science AAV Enhancer Collection
TypeCollection...Gore, B. B., Weed, N., Omstead, V., Bishaw, Y., Shapovalova, N. V., Martinez, R. A., Fong, O., Yao, S., Mortrud... -
Validated gRNA Sequences
TypeCollection...GAAGCGGGCAAAGGGGCGAC 58780 cut/nick S. pyogenes 24954249 Yamamoto apoea D. rerio GGATGAGCCAAGAAGCCGCT 42241 cut S. pyogenes... -
Trimmer Lab NeuroMab Collection
TypeCollection...IgG2a 188214 Anti-GST [N100/13R ] GST Schistosoma japonicum Mouse IgG2a 188215 Anti-TrpC7 [N64A/36R ] TrpC7...GST scFv [N100/13] N100/13 scFv GST Schistosoma japonicum Mouse 190522 Aldh1L1 scFv [N103/31] N103/31 scFv... -
CRISPR Guide
TypeCollection...nickase (Cas9n) or dCas9 to a cytidine deaminase like APOBEC. Within the region of single-stranded DNA created...