Skip to main content

We narrowed to 132 results for: primer

Showing: 61 - 80 of 132 results
  1. Protocol - How to Design Primers

    Type
    Protocol
    ...folding. One also needs to avoid primer-primer annealing which creates primer dimers and disrupts the amplification... Protocols Designing Primers How to Design a Primer You may also like...Agarose Gel Electrophoresis Primer Design for PCR Oligonucleotide primers are necessary when running a...ends of the hybridized primers must point toward one another. The size of the primer is very important as...hand, a long primer is used to amplify a eukaryotic genomic DNA sample. However, a primer should not be... be too long (> 30-mer primers) or too short. Short primers produce inaccurate, nonspecific DNA amplification...temperature (Tm) of 50-60°C Primer pairs should have a Tm within 5°C of each other Primer pairs should not have...
  2. What is Polymerase Chain Reaction (PCR)

    Type
    Protocol
    ... Procedure Primer Design and PCR Design Primers. See our protocol on how to design primers . Note: (Link...stranded DNA. Anneal primers for 30 seconds at 55°C: The forward and reverse primers are stable within this...10 mM each nt) 2.5 μL Forward Primer (10 μM stock) 2.5 μL Reverse Primer (10 μM stock) 36.8 μL Sterile...10 mM each nt) 2.5 μL Forward Primer (10 μM stock) 2.5 μL Reverse Primer (10 μM stock) 0.2 μL Taq DNA ... mix so you know that the primers have been added, pipet the forward primer onto one side of the tube ...50µl – 2.5µl (fwd primer) – 2.5µl (rev primer) = 45µl volume of master mix to add to each PCR tube. Secure...placing it in the PCR machine. Diluting Primers Most people order primers from a company, which synthesizes ...
  3. Protocol - How to Perform Sequence Analysis

    Type
    Protocol
    ...selecting sequencing primers, including: Is the primer unique? Make sure the primer only anneals once within...information pages recommend 5’ and 3’ sequencing primers. These primers typically anneal to the backbone and can...entire construct. Is the primer an appropriate distance from the target? The primer should be a minimum of...available primers that can be used for sequencing? There are many widely used, common primers that are ...Addgene's Sequencing Primers for reference). Many sequencing cores have a list of common primers that can be requested...charge. What primers were used by Addgene during quality control? Addgene lists the primers used to obtain...custom primer, Addgene recommends using Addgene's sequencing results as a reference for primer design....
  4. Plasmid Cloning by PCR (with Protocols)

    Type
    Protocol
    ...recipient plasmid. Designing Primers for PCR Based Cloning The basic PCR primers for molecular cloning consist...site to the forward primer and the downstream restriction site to the reverse primer. Next, we need to ...site (GAATTC) to the 5’ end of this primer, making our Forward Primer 5'-GAATTCATGTGGCATATCTCGAAGTAC-3'.... within your primer. In our case, we will add TAAGCA, resulting in a final Forward Primer sequence of ...Sequence: Extra base pairs on the 5' end of the primer assist with restriction enzyme digestion (usually...8bp). Hybridization Sequence: The region of the primer that binds to the sequence to be amplified (usually...DNA sequence that we want to amplify and design primers that will bind to and replicate it. The following...
  5. Gibson Assembly Protocol

    Type
    Protocol
    ...the way to design the “stitching” primers and the amounts of primers to include in the Gibson reaction... once. Procedure Design your plasmid and order primers (see figure to the right). When designing your ...identical sequences can be created via PCR with primers that contain a 5′ end that is identical to an adjacent... the target sequence. One strategy is to order primers that are 60 bp long, with 30 bp matching the end... for correctly assembled plasmids by designing primers to split an antibiotic resistance gene to effectively...inserted is too long to include on overlapping PCR primers (>60 bp) but too short to make its own part (<150...reaction are different than with normal PCR primers (Gibson et al. , 2010). Number of fragments assembled simultaneously...
  6. Ligation Independent Cloning

    Type
    Protocol
    ...cloning vectors Protocol Step 1: Design Your Primers Primer design for LIC is often as simple as using ...For simplicity, only the 5' primer is shown here. Note: Use web-based primer design software to ensure ...must be built into the 5’ end of the respective primers. Below we use pNIC28-Bsa4 as an example of LIC ...codon or tag sequences (where appropriate). The primer length is dependent on the T4 Pol "chew back" reaction...add back the G and become stalled. Therefore, the primer must begin with the following T, so that there ... of 18 bp of your template sequence. 5' and 3' primers will have different leader sequences, but operate...melting temperature between 50-60°C for your PCR primers. Step 2: Linearize Vector In this example, the ...
  7. AAV ddPCR Titration

    Type
    Protocol
    ...87003-294 Primers/probe targeting ITR: ITR Forward Primer: 5’-CGGCCTCAGTGAGCGA ITR Reverse Primer: 5’-GGAACCCCTAGTGATGGAGTT...aliquots of master mixes, primers, and probes prior to use. Thaw the master mix, primers, and probe on ice before.... Ensure that primers, probe, 10X PCR buffer, and master mix are thawed. Vortex primers, probe and master... µL 250 nM Forward ITR Primer (10 µM) 1.8 µL 16.2 µL 900 nM Reverse ITR Primer (10 µM) 1.8 µL 16.2 µL ...vectors (AAV). This protocol specifically uses primers and probes targeting the ITR elements in the viral...
  8. Lentivirus ddPCR Titration

    Type
    Protocol
    ...Microcentrifuge tubes, VWR, 87003-294 Primers/probe targeting RRE: forward primer: tgtgccttggaatgctagt probe (FAM...µL 1X 20X RRE target primers/probe (FAM) 1 µL 9 µL 900 nM, 250 nM 20X RPP30 primers/probe (HEX/VIC) 1 µL...lentivirus vectors. This protocol specifically uses primers and probes targeting integrated copies of the Rev...target cells but can be modified for other targets. Primers and a probe against the cellular ribonuclease P... (2018) . Before Starting Thaw the master mix, primers/probe mixes and samples on ice before use. Wipe...(FAM): tttggaatcacacgacct reverse primer: aatttctctgtcccactccatc PrimePCR ddPCR Copy Number Assay: RPP30...ready to use. Preparing for ddPCR Thaw samples, primers/probe mixes, and master mix on ice. Before handling...
Showing: 61 - 80 of 132 results