We narrowed to 132 results for: primer
-
TypeBlog Post...unresolved and small, so I suggest designing your primer at least 50bp upstream of the sequence of interest...
-
Protocol - How to Design Primers
TypeProtocol...folding. One also needs to avoid primer-primer annealing which creates primer dimers and disrupts the amplification... Protocols Designing Primers How to Design a Primer You may also like...Agarose Gel Electrophoresis Primer Design for PCR Oligonucleotide primers are necessary when running a...ends of the hybridized primers must point toward one another. The size of the primer is very important as...hand, a long primer is used to amplify a eukaryotic genomic DNA sample. However, a primer should not be... be too long (> 30-mer primers) or too short. Short primers produce inaccurate, nonspecific DNA amplification...temperature (Tm) of 50-60°C Primer pairs should have a Tm within 5°C of each other Primer pairs should not have... -
Addgene's Top Blog Posts from 2020
TypeBlog Post...protein databases, DNA sequence manipulation, and primer design. Best wishes for the new year and your ... -
What is Polymerase Chain Reaction (PCR)
TypeProtocol... Procedure Primer Design and PCR Design Primers. See our protocol on how to design primers . Note: (Link...stranded DNA. Anneal primers for 30 seconds at 55°C: The forward and reverse primers are stable within this...10 mM each nt) 2.5 μL Forward Primer (10 μM stock) 2.5 μL Reverse Primer (10 μM stock) 36.8 μL Sterile...10 mM each nt) 2.5 μL Forward Primer (10 μM stock) 2.5 μL Reverse Primer (10 μM stock) 0.2 μL Taq DNA ... mix so you know that the primers have been added, pipet the forward primer onto one side of the tube ...50µl – 2.5µl (fwd primer) – 2.5µl (rev primer) = 45µl volume of master mix to add to each PCR tube. Secure...placing it in the PCR machine. Diluting Primers Most people order primers from a company, which synthesizes ... -
Protocol - How to Perform Sequence Analysis
TypeProtocol...selecting sequencing primers, including: Is the primer unique? Make sure the primer only anneals once within...information pages recommend 5’ and 3’ sequencing primers. These primers typically anneal to the backbone and can...entire construct. Is the primer an appropriate distance from the target? The primer should be a minimum of...available primers that can be used for sequencing? There are many widely used, common primers that are ...Addgene's Sequencing Primers for reference). Many sequencing cores have a list of common primers that can be requested...charge. What primers were used by Addgene during quality control? Addgene lists the primers used to obtain...custom primer, Addgene recommends using Addgene's sequencing results as a reference for primer design.... -
Easi-CRISPR: Generating Knock-In and Conditional Mouse Models
TypeBlog Post...protein), you can amplify the desired region using primers containing the homology arms on both sides and ...repair templates using Addgene plasmids. Design PCR primers to add T7 promoter-left homology arm and right ... -
Plasmid Cloning by PCR (with Protocols)
TypeProtocol...recipient plasmid. Designing Primers for PCR Based Cloning The basic PCR primers for molecular cloning consist...site to the forward primer and the downstream restriction site to the reverse primer. Next, we need to ...site (GAATTC) to the 5’ end of this primer, making our Forward Primer 5'-GAATTCATGTGGCATATCTCGAAGTAC-3'.... within your primer. In our case, we will add TAAGCA, resulting in a final Forward Primer sequence of ...Sequence: Extra base pairs on the 5' end of the primer assist with restriction enzyme digestion (usually...8bp). Hybridization Sequence: The region of the primer that binds to the sequence to be amplified (usually...DNA sequence that we want to amplify and design primers that will bind to and replicate it. The following... -
CRISPR Protocol for Genomic Deletions in Mammalian Cell Lines [Video]
TypeBlog Post...electroporation, sort your transfected cells via FACS, primer validation, and screening by PCR for biallelic ... -
Tag Your Favorite Yeast Genes with Ease
TypeBlog Post...been integrated. Simply design your amplification primers with the desired targeting homology—in frame, of... -
Lambda Red: A Homologous Recombination-based Technique for Genetic Engineering
TypeBlog Post...Substrate dsDNA inserts can be made by PCR using primers that amplify the DNA sequence of interest and flank...the targeted insert site (Figure 2, top). These primers are typically ~70 nucleotides long (20 nucleotides... -
Gibson Assembly Protocol
TypeProtocol...the way to design the “stitching” primers and the amounts of primers to include in the Gibson reaction... once. Procedure Design your plasmid and order primers (see figure to the right). When designing your ...identical sequences can be created via PCR with primers that contain a 5′ end that is identical to an adjacent... the target sequence. One strategy is to order primers that are 60 bp long, with 30 bp matching the end... for correctly assembled plasmids by designing primers to split an antibiotic resistance gene to effectively...inserted is too long to include on overlapping PCR primers (>60 bp) but too short to make its own part (<150...reaction are different than with normal PCR primers (Gibson et al. , 2010). Number of fragments assembled simultaneously... -
Ligation Independent Cloning
TypeProtocol...cloning vectors Protocol Step 1: Design Your Primers Primer design for LIC is often as simple as using ...For simplicity, only the 5' primer is shown here. Note: Use web-based primer design software to ensure ...must be built into the 5’ end of the respective primers. Below we use pNIC28-Bsa4 as an example of LIC ...codon or tag sequences (where appropriate). The primer length is dependent on the T4 Pol "chew back" reaction...add back the G and become stalled. Therefore, the primer must begin with the following T, so that there ... of 18 bp of your template sequence. 5' and 3' primers will have different leader sequences, but operate...melting temperature between 50-60°C for your PCR primers. Step 2: Linearize Vector In this example, the ... -
Using Addgene's New Viral Service for Your Research
TypeBlog Post...the Addgene Blog Using Virus in Your Research: A Primer for Beginners Lentiviral Vector Uses and Overview... -
Identifying Sequence Elements with SnapGene's Feature Database
TypeBlog Post...strategies set experiments back days or even weeks. Primer design was done painstakingly by hand. Records ... -
Plasmids 101: NGS Quality Control for Pooled Libraries
TypeBlog Post...sequencing (NGS). For gRNA libraries, you’ll design primers to create 200-300 bp sequencing products using ... -
AAV ddPCR Titration
TypeProtocol...87003-294 Primers/probe targeting ITR: ITR Forward Primer: 5’-CGGCCTCAGTGAGCGA ITR Reverse Primer: 5’-GGAACCCCTAGTGATGGAGTT...aliquots of master mixes, primers, and probes prior to use. Thaw the master mix, primers, and probe on ice before.... Ensure that primers, probe, 10X PCR buffer, and master mix are thawed. Vortex primers, probe and master... µL 250 nM Forward ITR Primer (10 µM) 1.8 µL 16.2 µL 900 nM Reverse ITR Primer (10 µM) 1.8 µL 16.2 µL ...vectors (AAV). This protocol specifically uses primers and probes targeting the ITR elements in the viral... -
Lentivirus ddPCR Titration
TypeProtocol...Microcentrifuge tubes, VWR, 87003-294 Primers/probe targeting RRE: forward primer: tgtgccttggaatgctagt probe (FAM...µL 1X 20X RRE target primers/probe (FAM) 1 µL 9 µL 900 nM, 250 nM 20X RPP30 primers/probe (HEX/VIC) 1 µL...lentivirus vectors. This protocol specifically uses primers and probes targeting integrated copies of the Rev...target cells but can be modified for other targets. Primers and a probe against the cellular ribonuclease P... (2018) . Before Starting Thaw the master mix, primers/probe mixes and samples on ice before use. Wipe...(FAM): tttggaatcacacgacct reverse primer: aatttctctgtcccactccatc PrimePCR ddPCR Copy Number Assay: RPP30...ready to use. Preparing for ddPCR Thaw samples, primers/probe mixes, and master mix on ice. Before handling... -
CRISPR References and Information
TypeCollection...design (10 different prediction scores), clone (primer design), and evaluate gRNAs, as well as predict... -
A Novice's Perspective on Neuroscience - SfN2017
TypeBlog Post...Neuroscience, and the Future of Neuroengineering Primer on Optogenetics Resources at Addgene.org Addgene's... -
Synthesized by Ginkgo Bioworks, Shared by Addgene: SARS-CoV-2 Plasmids for Many Expression Systems
TypeBlog Post...isolated plasmid DNA with appropriate sequencing primers, and hand deliver them to our Sanger provider. ...