Skip to main content

We narrowed to 816 results for: MAL

Showing: 781 - 800 of 816 results
  1. Protocol - Over-Agar Antibiotic Plating

    Type
    Protocol
    ...through the use of a selection curve to determine optimal antibiotic concentration. Last Update: Oct. 27,...pipetting and spreading Bunsen burner (or other small flame source) Incubator Reagents 6 cm diameter LB... the liquid is mostly absorbed (there is a very small visible volume of pooled liquid remaining on the...over-agar Plate shows several individual colonies with smaller size than the 1 mg/mL and 2 mg/mL plates and effective...
  2. Protocol - Bacterial Transformation

    Type
    Protocol
    ... nearly all plasmids (even those designed for mammalian cell expression) carry both a bacterial origin... cells, which come frozen and are prepared for optimal transformation efficiencies upon thawing. For the...important if you will be transforming with very small amounts of DNA or if you're multiple plasmids at...the cells by centrifugation and resuspend in a smaller volume of LB so that there isn't too much liquid...
  3. What is Polymerase Chain Reaction (PCR)

    Type
    Protocol
    ...for 1 minute at 72°C: The Taq polymerase has an optimal temperature around 70-75°C so this step enables...creating a “master mix,” which minimizes the number of small volumes you need to pipet. If you are using the ...needs to reconstitute their primers in liquid, normally sterile dH 2 O. To make a 100uM stock of any primer...efficiently. Taq Buffer with MgCl 2 : Provides an optimal and stable chemical environment for the DNA polymerase...
  4. Lentivirus ddPCR Titration

    Type
    Protocol
    ...kDa subunit (RPP30) are used as a control for normalization. The dilution series outlined in this protocol...5425R Droplet digital PCR System, Bio-Rad, DX200 Thermal Cycler, Bio-Rad, T100 PCR Plate Sealer, Bio-Rad...plate has been sealed, proceed to thermocycling. Thermal Cycling Run the following PCR parameters: Cycling...risk of contaminating reagents we recommend making small aliquots of master mixes, and primers/probe mixes...
  5. Video Library

    Type
    Protocol
    ...Deletions with CRISPR Generate genomic deletions in mammalian cells lines using CRISPR/Cas9 Genomic Deletions...adeno-associated virus from a preparation produced in mammalian cells AAV Purification by Iodixanol Gradient Ultracentrifugation...culture in the lab. Blog post: 10 Basic tips for mammalian cell culture Aseptic Technique Aseptic technique...
  6. Protocols for Molecular Biology, Plasmid Cloning, and Viral Preps

    Type
    Protocol
    ...General Transfection Introduce plasmid DNA to mammalian cells Lentivirus Production Produce lentivirus...adeno-associated virus from a preparation produced in mammalian cells Watch the Video! AAV Titration by qPCR Using...to Video Transfection Introduce plasmid DNA to mammalian cells to produce antibodies Antibody Purification...
  7. General Transfection

    Type
    Protocol
    ...Use this protocol to transfect mammalian cells with your plasmid of interest....protocol describes a general method for transfecting mammalian cells using linear polyethylenimine. Transfections...are below passage 20 for viral production. The optimal mass DNA:mass PEI ratio will need to be empirically...
  8. Using a Light Microscope Protocol

    Type
    Protocol
    ...These tools allow you to observe specimens much smaller than you would be able to with your naked eye, ...advantage of the physical properties of light to detect small objects. Two of the most important properties of...needed, you can also use the fine focus knob (the smaller of the focus knobs) to make minor adjustments to...
  9. Plasmid Cloning by Restriction Enzyme Digest (with Protocols)

    Type
    Protocol
    ...). You might need to express YGOI in cultured mammalian cells. The problem is that the only version of...Using subcloning, you can easily move YGOI into a mammalian expression vector. Design (Choosing enzymes) Many...purpose. Congratulations, you now have YGOI in a mammalian expression vector and can begin your studies. ...
  10. Virus Protocol - Generating Stable Cell Lines

    Type
    Protocol
    ...transfection. Some lentiviral vectors deliver mammalian antibiotic resistance (e.g., puromycin, blasticidin...cycles. Procedure Before beginning, determine the optimal dose of selective reagent for your target cell ...important to do regular media changes and maintain optimal growth conditions for the surviving cells. Even...
  11. AAV Titration by qPCR Using SYBR Green Technology

    Type
    Protocol
    ...internal passive reference (typically ROX dye), to normalize non-PCR–related fluorescence fluctuations and ... a validated standard curve is obtained, make a small aliquot of each standard (enough for 1 or 2 plates...acceptable) Baseline removal: all samples will have some small amount of background signal that is most evident...
  12. Isolating a Monoclonal Cell Population by Limiting Dilution

    Type
    Protocol
    ...medium with increased serum concentrations, may be optimal for different cell types. Before starting this ...because the buildup of waste products could be suboptimal for cell growth. This conditioned medium will...10 5 cells/mL) = 0.125 µL Because this is such a small volume, first make 1 mL of a 1:100 dilution of the...
  13. AAV ddPCR Titration

    Type
    Protocol
    ...risk of contaminating reagents we recommend making small aliquots of master mixes, primers, and probes prior...302411100 Droplet Digital PCR System, Bio-Rad, DX200 Thermal Cycler, Bio-Rad, T100 PCR Plate Sealer, Bio-Rad...plate has been sealed, proceed to thermocycling. Thermal Cycling Run the following PCR parameters. Cycling...
  14. Weighing Reagents Protocol

    Type
    Protocol
    ...accuracy as these types of scales display more decimal places. Pro-Tip If you’re weighing out an amount...amount of reagent that will be resuspended in a small volume (e.g. 0.02 g to resuspend in 1 mL), you may...
  15. Science Guides

    Type
    Guide
    ...pathways. Receptors are remotely controlled via small molecules, which allows for specific control of ...
  16. Ligation Independent Cloning

    Type
    Protocol
    ...sterile water (instead of TE buffer) to ensure optimal salt concentrations in subsequent reactions. Step...per annealing reaction. This should be done in a small volume with no additional water (<5 μl). It is advisable...
  17. Protocol - How to Inoculate a Bacterial Culture

    Type
    Protocol
    ...time (approximately 18–30 h). On the other hand, smaller plasmids can be present in large numbers, 50 or...may help to increase the density of the culture. Normally cultures shake at 150–250 rpm, increase this to...
  18. Handling Plasmids from Addgene - Purifying Plasmid DNA

    Type
    Protocol
    ...the bacteria back into suspension, but within a smaller volume of buffer that is compatible with the next... genomic DNA to precipitate, while leaving the smaller plasmids free in solution. Pellet the proteins ...
  19. Sequencing Primers

    Type
    Guide
    ...Reverse MBP-F GATGAAGCCCTGAAAGACGCGCAG 3' end of maltose binding protein Forward mCherry-F CCCCGTAATGCAGAAGAAGA...
  20. Pouring LB Agar Plates

    Type
    Protocol
    ...~220 mL) just in case we spill anything or have small errors in measurement. You should also always make...-mix slightly. Even so, you should always use thermally insulated gloves when removing anything from the...
Showing: 781 - 800 of 816 results