Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 852 results for: Met

Showing: 821 - 840 of 852 results

  2. Water Bath Protocol

    Type
    Protocol
    ... or 70% ethanol Distilled water Disinfectant Thermometer Water bath weights and floats Reagents None needed... example, number of drops per liter. Place a thermometer in the water bath. Oftentimes, the water bath...bath will have a spot to secure the thermometer in place. Turn the water bath on and set the appropriate...

  3. Using a Light Microscope Protocol

    Type
    Protocol
    ...your ocular lens. For example, if you observe something using the 10x objective and your ocular lens is...a slide, you can secure it into place using the metal clips on the stage. Turn on the power source and...drawing skills. Regardless of your image capture method, be sure to record the magnification used, any ...

  4. Coomassie Purity Stain of Recombinant Antibodies

    Type
    Protocol
    ... we list the specific equipment, reagents, and methods that we use in our lab at Addgene. Equipment and...chamber Power supply Rocking platform Fume hood Metal spatula Razor blade Plastic tray Gel imaging system...chamber. Remove the gel from the chamber. Use the metal spatula to gently break the gel cast open. Use a...

  5. Optogenetics Guide

    Type
    Guide
    ...excitation of distinct neural populations. Nat Methods. 11(3):338-46. PMID 24509633 Lin, J. 2011. A User... comparative analysis of microbial opsins. Nat Methods. 9(2):159-72. PMID 22179551 Saunders A, Johnson...2016. Enhancing Channelrhodopsins: An Overview. Methods Mol Biol. 1408:141-65. PMID 26965121 Yizhar O, ...

  6. AAV Production in HEK293 Cells

    Type
    Protocol
    ... pipette 200–1000 µL single channel pipette Hemocytometer or cell counter Ice bucket CO 2 incubator Pipet...Pipet controller Hazardous waste container pH meter Stir plate Magnetic stir bar Sonicator Ear protection...suspension (no clumps). Count cells using a hemocytometer or cell counter. Seed 350 million cells from...

  7. CRISPR Library Amplification

    Type
    Protocol
    ...concentrations of DNA. In our hands fluorescent dye methods tend to report lower values than Nanodrop, although...been designed with Nanodrop as the quantification method. If all Maxipreps appear to contain sufficient ...Maxipreps as yield can dramatically plateau and sometimes fall off entirely if the column or reagents are...

  8. Protocol - How to Perform a Diagnostic Digest

    Type
    Protocol
    ...restriction digests have become the most widely used method scientists employ to selectively move a specific...Although this is never an ideal cloning strategy, sometimes it cannot be avoided. If you do have to do so,...

  9. Ligation Independent Cloning

    Type
    Protocol
    ...Independent Cloning You may also like... Cloning Methods Empty Backbone Guide Molecular Biology Protocols...time-consuming ligation step of traditional cloning methods. In traditional cloning, base-pairing in the short...

  11. Sequencing Primers

    Type
    Guide
    ...CATCTCAGTGCAACTAAA (Invitrogen) Drosophila metallothionein promoter, forward primer MMLV-F ATCAGTTCGCTTCTCGCTTC...reverse primer MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC...

  12. Transfection for Recombinant Antibodies

    Type
    Protocol
    ... we list the specific equipment, reagents, and methods that we use in our lab at Addgene. Equipment and...bead bath Vortex Stir bar Magnetic stir plate pH meter Reagents HEK293 cells Recombinant antibody plasmid...

  14. Virus Protocol - Generating Stable Cell Lines

    Type
    Protocol
    ...two 75 cm 2 flasks, etc. Pro-Tip This selection method results in a polyclonal cell population, meaning...screening. Sanjana NE, Shalem O, Zhang F. Nature Methods. 2014 Aug;11(8):783-4 (Link opens in a new window...

  15. AAV ddPCR Titration

    Type
    Protocol
    ...reached, place the PCR plate with the foil onto the metal support block. Place the block in the plate sealer...thermocycling. Thermal Cycling Run the following PCR parameters. Cycling Step Temperature (°C) Time (min) Ramp...

  16. Kit Free RNA Extraction

    Type
    Protocol
    ...the quality of your RNA sample(s) using a spectrophotometer (such as a Nanodrop), agarose gel, or bioanalyzer...

  18. Protocol - How to Streak a Plate

    Type
    Protocol
    ...often true for large unstable plasmids, which sometimes recombine at 37 °C. Be sure to check this before...

  19. Guide to Using Pooled Libraries

    Type
    Guide
    ...screens. Both types of screen employ a selection method relevant to the phenotype being studied. Examples...
Showing: 821 - 840 of 852 results