We narrowed to 847 results for: Met

... pipette 200–1000 µL single channel pipette Hemocytometer or cell counter Ice bucket CO 2 incubator Pipet...Pipet controller Hazardous waste container pH meter Stir plate Magnetic stir bar Sonicator Ear protection...suspension (no clumps). Count cells using a hemocytometer or cell counter. Seed 350 million cells from...

...concentrations of DNA. In our hands fluorescent dye methods tend to report lower values than Nanodrop, although...been designed with Nanodrop as the quantification method. If all Maxipreps appear to contain sufficient ...Maxipreps as yield can dramatically plateau and sometimes fall off entirely if the column or reagents are...

...restriction digests have become the most widely used method scientists employ to selectively move a specific...Although this is never an ideal cloning strategy, sometimes it cannot be avoided. If you do have to do so,...

...Independent Cloning You may also like... Cloning Methods Empty Backbone Guide Molecular Biology Protocols...time-consuming ligation step of traditional cloning methods. In traditional cloning, base-pairing in the short...

...Quantification Measure DNA concentration with a spectrophotometer Restriction Digests Cut and analyze plasmid...cells Antibody Validation Using the Indirect ELISA Method Run an indirect ELISA against a purified antigen...

...Reverse MT Forward CATCTCAGTGCAACTAAA Drosophila metallothionein promoter Forward MMLV-F ATCAGTTCGCTTCTCGCTTC...virus Reverse MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC...

...studies. Advantages Broad range of perturbation methods Can target systems incompatible with CRISPR Can...screens. Both types of screen employ a selection method relevant to the phenotype being studied. An example...

... we list the specific equipment, reagents, and methods that we use in our lab at Addgene. Equipment and...bead bath Vortex Stir bar Magnetic stir plate pH meter Reagents HEK293 cells Recombinant antibody plasmid...

...from the gel via your favorite gel purification method, it is important to determine the concentration...calculate this based on DNA concentration alone. One method is to conduct 2 ligations for each plasmid you ...

...two 75 cm 2 flasks, etc. Pro-Tip This selection method results in a polyclonal cell population, meaning...screening. Sanjana NE, Shalem O, Zhang F. Nature Methods. 2014 Aug;11(8):783-4 (Link opens in a new window...

...reached, place the PCR plate with the foil onto the metal support block. Place the block in the plate sealer...thermocycling. Thermal Cycling Run the following PCR parameters. Cycling Step Temperature (°C) Time (min) Ramp...

...the quality of your RNA sample(s) using a spectrophotometer (such as a Nanodrop), agarose gel, or bioanalyzer...

... protect your feet. Pro-Tip If they are able, sometimes scientists work for a long time while standing...

...often true for large unstable plasmids, which sometimes recombine at 37 °C. Be sure to check this before...

...manually call the correct base at the position. Sometimes an “N” is the result of an erroneous insertion...

...Inducible by arabinose Promoter of the arabinose metabolic operon trp Repressible by tryptophan Promoter ...

... some biohazardous waste, an autoclave or other method for decontaminating must be used for proper disposal...

... Introduction This protocol describes a general method for transfecting mammalian cells using linear polyethylenimine...

...your transformation procedure is working. TIP: Sometimes less is more. Although it may be counter-intuitive...

...digestion . Most restriction enzymes digest DNA asymmetrically across their recognition sequence, which results...